Transcript: Mouse NM_010119.5

Mus musculus EH-domain containing 1 (Ehd1), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Ehd1 (13660)
Length:
3182
CDS:
80..1684

Additional Resources:

NCBI RefSeq record:
NM_010119.5
NBCI Gene record:
Ehd1 (13660)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010119.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093336 CAACGATATAGCTCGGCTGAT pLKO.1 1240 CDS 100% 4.050 5.670 N Ehd1 n/a
2 TRCN0000093338 CGACTTCCCAAGCCTGCGTAA pLKO.1 1132 CDS 100% 1.350 1.890 N Ehd1 n/a
3 TRCN0000093334 CCTCAGCTCTTGAATAGGAAA pLKO.1 1842 3UTR 100% 4.950 3.960 N Ehd1 n/a
4 TRCN0000093337 CATCATTGACACTCCTGGGAT pLKO.1 529 CDS 100% 2.640 1.848 N Ehd1 n/a
5 TRCN0000093335 CGGGAAAGAGAGCAAGAAGAA pLKO.1 1045 CDS 100% 4.950 2.970 N Ehd1 n/a
6 TRCN0000053435 GAGTTCTCAGAAGTCATCAAA pLKO.1 674 CDS 100% 5.625 2.813 Y EHD3 n/a
7 TRCN0000174222 GAGTTCTCAGAAGTCATCAAA pLKO.1 674 CDS 100% 5.625 2.813 Y EHD3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010119.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07708 pDONR223 100% 91% 99.4% None (many diffs) n/a
2 ccsbBroad304_07708 pLX_304 0% 91% 99.4% V5 (many diffs) n/a
3 TRCN0000477138 GTCGTGATGTGGTTCGTTCTCGGT pLX_317 16.7% 91% 99.4% V5 (many diffs) n/a
Download CSV