Transcript: Mouse NM_010146.2

Mus musculus epilepsy, progressive myoclonic epilepsy, type 2 gene alpha (Epm2a), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Epm2a (13853)
Length:
1079
CDS:
27..1019

Additional Resources:

NCBI RefSeq record:
NM_010146.2
NBCI Gene record:
Epm2a (13853)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080680 GCTCAAGCACAACAAGACTTT pLKO.1 954 CDS 100% 4.950 3.960 N Epm2a n/a
2 TRCN0000080681 GCACATATAATGAGGACAACT pLKO.1 352 CDS 100% 4.950 3.465 N Epm2a n/a
3 TRCN0000002591 ACACCAATGAAATGAAGCACA pLKO.1 427 CDS 100% 2.640 1.848 N EPM2A n/a
4 TRCN0000080682 CCACTATGTGATTGGCTGGAA pLKO.1 866 CDS 100% 2.640 1.848 N Epm2a n/a
5 TRCN0000002592 CGTTCTGGTACAAGTTCCTGA pLKO.1 271 CDS 100% 2.640 1.848 N EPM2A n/a
6 TRCN0000234317 TCCAGACTGAATGGGATATTG pLKO_005 598 CDS 100% 13.200 7.920 N EPM2A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010146.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11248 pDONR223 100% 21.7% 23% None (many diffs) n/a
2 ccsbBroad304_11248 pLX_304 0% 21.7% 23% V5 (many diffs) n/a
3 TRCN0000466153 CTTCTATGCACGCCGCGCGACCAG pLX_317 100% 21.7% 23% V5 (many diffs) n/a
Download CSV