Transcript: Mouse NM_010279.3

Mus musculus glial cell line derived neurotrophic factor family receptor alpha 1 (Gfra1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Gfra1 (14585)
Length:
4664
CDS:
448..1854

Additional Resources:

NCBI RefSeq record:
NM_010279.3
NBCI Gene record:
Gfra1 (14585)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010279.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000306256 AGATTCTTCCGGATCTTATTT pLKO_005 2224 3UTR 100% 15.000 21.000 N Gfra1 n/a
2 TRCN0000306314 TTACCACCGTGTGCTAATTTG pLKO_005 1621 CDS 100% 13.200 18.480 N Gfra1 n/a
3 TRCN0000079035 GCAGTCCCGTTCATATCAGAT pLKO.1 847 CDS 100% 4.950 6.930 N Gfra1 n/a
4 TRCN0000326480 GCAGTCCCGTTCATATCAGAT pLKO_005 847 CDS 100% 4.950 6.930 N Gfra1 n/a
5 TRCN0000306255 CAGATCTCGCCTTGCAGATTT pLKO_005 1215 CDS 100% 13.200 9.240 N Gfra1 n/a
6 TRCN0000079033 GCAGACTCTATCTTGTACTAA pLKO.1 2326 3UTR 100% 5.625 3.938 N Gfra1 n/a
7 TRCN0000079034 GCAGTACACATCTCTGTCTTT pLKO.1 1673 CDS 100% 4.950 3.465 N Gfra1 n/a
8 TRCN0000079037 GAAGCAGAAGTCTCTCTACAA pLKO.1 684 CDS 100% 4.950 2.970 N Gfra1 n/a
9 TRCN0000326405 GAAGCAGAAGTCTCTCTACAA pLKO_005 684 CDS 100% 4.950 2.970 N Gfra1 n/a
10 TRCN0000079036 TGTCTGTATCATTGGCAGAAA pLKO.1 1826 CDS 100% 4.950 2.970 N Gfra1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010279.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000468740 CACCCGGGCCTTACATTGGCTGAT pLX_317 16.2% 87.5% 91.8% V5 (many diffs) n/a
2 ccsbBroadEn_06270 pDONR223 100% 87.4% 91.6% None (many diffs) n/a
3 ccsbBroad304_06270 pLX_304 0% 87.4% 91.6% V5 (many diffs) n/a
Download CSV