Transcript: Mouse NM_010293.3

Mus musculus glycerol kinase-like 1 (Gykl1), mRNA.

Source:
NCBI, updated 2013-04-17
Taxon:
Mus musculus (mouse)
Gene:
Gykl1 (14625)
Length:
1915
CDS:
44..1693

Additional Resources:

NCBI RefSeq record:
NM_010293.3
NBCI Gene record:
Gykl1 (14625)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010293.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024628 GTGAGTAGTATGGTGATATTA pLKO.1 1652 CDS 100% 15.000 21.000 N Gykl1 n/a
2 TRCN0000361271 ATGGTCGCGACCCTAGTATTT pLKO_005 1602 CDS 100% 13.200 18.480 N Gykl1 n/a
3 TRCN0000024624 CCCAGATCAATGTCGAGGAAA pLKO.1 1509 CDS 100% 4.950 6.930 N Gykl1 n/a
4 TRCN0000361222 CATGTAAGGTGTCCCATAAAT pLKO_005 1687 CDS 100% 15.000 12.000 N Gykl1 n/a
5 TRCN0000024626 GCCTTCCAATCAGCACTTATT pLKO.1 468 CDS 100% 13.200 9.240 N Gykl1 n/a
6 TRCN0000024627 GCTGAATTACTTTGTCATCAT pLKO.1 140 CDS 100% 4.950 3.465 N Gykl1 n/a
7 TRCN0000024625 CCTGTCTATTATGCCCTGGAA pLKO.1 980 CDS 100% 2.640 1.848 N Gykl1 n/a
8 TRCN0000367966 ATTCAGTCTTCATCGGAAATT pLKO_005 1058 CDS 100% 13.200 7.920 N Gykl1 n/a
9 TRCN0000037634 CCGGAGTTCTTCTGAGATCTA pLKO.1 742 CDS 100% 4.950 2.970 N GK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010293.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.