Transcript: Mouse NM_010311.3

Mus musculus guanine nucleotide binding protein, alpha z subunit (Gnaz), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Gnaz (14687)
Length:
2435
CDS:
703..1770

Additional Resources:

NCBI RefSeq record:
NM_010311.3
NBCI Gene record:
Gnaz (14687)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010311.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098274 CAGCGCCGTGAAATCAAACTT pLKO.1 790 CDS 100% 5.625 7.875 N Gnaz n/a
2 TRCN0000098270 CGTCAAGGTTTCCTGAAGTTT pLKO.1 2048 3UTR 100% 5.625 3.938 N Gnaz n/a
3 TRCN0000036777 GACACCAGTAACATCCAGTTT pLKO.1 1687 CDS 100% 4.950 3.465 N GNAZ n/a
4 TRCN0000289342 GACACCAGTAACATCCAGTTT pLKO_005 1687 CDS 100% 4.950 3.465 N GNAZ n/a
5 TRCN0000098272 GACAGATGTCATCATACAGAA pLKO.1 1722 CDS 100% 4.950 3.465 N Gnaz n/a
6 TRCN0000098273 CCTCTTTGACTCCATCTGCAA pLKO.1 1449 CDS 100% 2.640 1.848 N Gnaz n/a
7 TRCN0000098271 GCAGTGACAGATGTCATCATA pLKO.1 1717 CDS 100% 5.625 3.375 N Gnaz n/a
8 TRCN0000036774 CAGAACAATCTCAAGTACATT pLKO.1 1738 CDS 100% 5.625 3.938 N GNAZ n/a
9 TRCN0000289344 CAGAACAATCTCAAGTACATT pLKO_005 1738 CDS 100% 5.625 3.938 N GNAZ n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010311.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06295 pDONR223 100% 92.2% 98% None (many diffs) n/a
2 ccsbBroad304_06295 pLX_304 0% 92.2% 98% V5 (many diffs) n/a
3 TRCN0000478848 GGCTACTGCGGCAAGCCGTCTGGA pLX_317 25.8% 92.2% 98% V5 (many diffs) n/a
4 ccsbBroadEn_06296 pDONR223 100% 92.1% 98.3% None (many diffs) n/a
5 ccsbBroad304_06296 pLX_304 0% 92.1% 98.3% V5 (many diffs) n/a
6 TRCN0000468051 TAGTCTGCGGCAAGACTCCTGACG pLX_317 34.1% 92.1% 98.3% V5 (many diffs) n/a
7 ccsbBroadEn_06294 pDONR223 100% 92.1% 98% None (many diffs) n/a
8 ccsbBroad304_06294 pLX_304 0% 92.1% 98% V5 (many diffs) n/a
9 TRCN0000469414 CAACTTGCTGTCACGTGCAAGCGC pLX_317 44.9% 92.1% 98% V5 (many diffs) n/a
Download CSV