Transcript: Mouse NM_010317.3

Mus musculus guanine nucleotide binding protein (G protein), gamma 4 (Gng4), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Gng4 (14706)
Length:
3200
CDS:
453..680

Additional Resources:

NCBI RefSeq record:
NM_010317.3
NBCI Gene record:
Gng4 (14706)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010317.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037068 AGCATCTCCCAGGCCAGGAAA pLKO.1 486 CDS 100% 1.650 1.155 N Gng4 n/a
2 TRCN0000037065 CTGCATGGACAGGGTGAAGGT pLKO.1 533 CDS 100% 0.880 0.616 N Gng4 n/a
3 TRCN0000037067 TCATCATCCCAGTGCCTGCCT pLKO.1 613 CDS 100% 0.220 0.154 N Gng4 n/a
4 TRCN0000037066 CCAGGCCAGGAAAGCCGTGGA pLKO.1 494 CDS 100% 0.000 0.000 N Gng4 n/a
5 TRCN0000037064 CCTGGCCTACTGTGAAGCCCA pLKO.1 575 CDS 100% 0.000 0.000 N Gng4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010317.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00657 pDONR223 100% 89.7% 98.6% None (many diffs) n/a
2 ccsbBroad304_00657 pLX_304 0% 89.7% 98.6% V5 (many diffs) n/a
3 TRCN0000470212 ACCTGTCAGCCCGGTTGATGGGTA pLX_317 100% 89.7% 98.6% V5 (many diffs) n/a
Download CSV