Transcript: Mouse NM_010498.3

Mus musculus iduronate 2-sulfatase (Ids), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ids (15931)
Length:
4988
CDS:
183..1841

Additional Resources:

NCBI RefSeq record:
NM_010498.3
NBCI Gene record:
Ids (15931)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010498.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348245 CAAAGTGAACTAAGGTATAAT pLKO_005 2072 3UTR 100% 15.000 10.500 N Ids n/a
2 TRCN0000101677 CCAGAATCTTCAGAAGCATTT pLKO.1 1493 CDS 100% 10.800 7.560 N Ids n/a
3 TRCN0000334333 CCAGAATCTTCAGAAGCATTT pLKO_005 1493 CDS 100% 10.800 7.560 N Ids n/a
4 TRCN0000101675 CCACAACACAATTATTGCTTT pLKO.1 1160 CDS 100% 4.950 3.465 N Ids n/a
5 TRCN0000334411 CCACAACACAATTATTGCTTT pLKO_005 1160 CDS 100% 4.950 3.465 N Ids n/a
6 TRCN0000101678 CCTGTATGACTTCAATTCCTA pLKO.1 491 CDS 100% 3.000 2.100 N Ids n/a
7 TRCN0000334410 CCTGTATGACTTCAATTCCTA pLKO_005 491 CDS 100% 3.000 2.100 N Ids n/a
8 TRCN0000101679 ACAGCAACTTTGATGTTGCTA pLKO.1 1231 CDS 100% 0.300 0.210 N Ids n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010498.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10899 pDONR223 100% 47.9% 46.1% None (many diffs) n/a
2 ccsbBroad304_10899 pLX_304 0% 47.9% 46.1% V5 (many diffs) n/a
3 TRCN0000466249 TATAGTCATACGTCTCGCGCGTCA pLX_317 28.9% 47.9% 46.1% V5 (many diffs) n/a
Download CSV