Transcript: Mouse NM_010583.3

Mus musculus IL2 inducible T cell kinase (Itk), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Itk (16428)
Length:
4274
CDS:
106..1965

Additional Resources:

NCBI RefSeq record:
NM_010583.3
NBCI Gene record:
Itk (16428)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010583.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361243 AGCACTGGCTTTCGGTTATAC pLKO_005 1816 CDS 100% 13.200 18.480 N Itk n/a
2 TRCN0000367979 TAGCATCCCGTGCCACTATAA pLKO_005 315 CDS 100% 13.200 18.480 N Itk n/a
3 TRCN0000023343 CGTTTCTTTGTCTTAACGAAA pLKO.1 190 CDS 100% 4.950 6.930 N Itk n/a
4 TRCN0000023340 CGTGCCACTATAAATACCCTT pLKO.1 323 CDS 100% 2.640 3.696 N Itk n/a
5 TRCN0000361241 TATCCAAGTATCACCCTAATT pLKO_005 455 CDS 100% 13.200 10.560 N Itk n/a
6 TRCN0000361242 GAAATGCAAGAGGTGATTAAA pLKO_005 2405 3UTR 100% 15.000 10.500 N Itk n/a
7 TRCN0000023339 CCAAGCAGTTACCTGGTAGAA pLKO.1 769 CDS 100% 4.950 3.465 N Itk n/a
8 TRCN0000023341 CCAGTACAATGGAGGAGGTTT pLKO.1 1071 CDS 100% 4.950 3.465 N Itk n/a
9 TRCN0000023342 CCTGAAGAAACCCTGGTCATT pLKO.1 616 CDS 100% 4.950 3.465 N Itk n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010583.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00886 pDONR223 100% 87.9% 94.1% None (many diffs) n/a
2 ccsbBroad304_00886 pLX_304 0% 87.9% 94.1% V5 (many diffs) n/a
3 ccsbBroadEn_14676 pDONR223 0% 87.9% 94.1% None (many diffs) n/a
4 ccsbBroad304_14676 pLX_304 0% 87.9% 94.1% V5 (many diffs) n/a
5 TRCN0000489937 GGCACATGTTGTATCCCCAGCACT pLX_317 23.5% 87.7% 94% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV