Transcript: Mouse NM_010593.2

Mus musculus junction plakoglobin (Jup), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Jup (16480)
Length:
5009
CDS:
164..2401

Additional Resources:

NCBI RefSeq record:
NM_010593.2
NBCI Gene record:
Jup (16480)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010593.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089919 CCACTGGTCAAGGCAACTATT pLKO.1 1649 CDS 100% 13.200 18.480 N Jup n/a
2 TRCN0000325890 CCACTGGTCAAGGCAACTATT pLKO_005 1649 CDS 100% 13.200 18.480 N Jup n/a
3 TRCN0000089920 CGTAGAATCTGTCCTGTTCTA pLKO.1 877 CDS 100% 0.495 0.396 N Jup n/a
4 TRCN0000089921 CAACAAGAACAACCCTAAGTT pLKO.1 994 CDS 100% 5.625 3.938 N Jup n/a
5 TRCN0000325817 CAACAAGAACAACCCTAAGTT pLKO_005 994 CDS 100% 5.625 3.938 N Jup n/a
6 TRCN0000089922 CTGACCTGCAACAACAGCAAA pLKO.1 1415 CDS 100% 4.950 3.465 N Jup n/a
7 TRCN0000325818 CTGACCTGCAACAACAGCAAA pLKO_005 1415 CDS 100% 4.950 3.465 N Jup n/a
8 TRCN0000089918 GCGCTGTTTCTCACCTGGAAA pLKO.1 2416 3UTR 100% 4.950 3.465 N Jup n/a
9 TRCN0000325815 GCGCTGTTTCTCACCTGGAAA pLKO_005 2416 3UTR 100% 4.950 3.465 N Jup n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010593.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06466 pDONR223 100% 89.6% 98.1% None (many diffs) n/a
2 ccsbBroad304_06466 pLX_304 0% 89.6% 98.1% V5 (many diffs) n/a
3 TRCN0000479951 ATGCGCCAACTCTTATTAGATAAT pLX_317 14% 89.6% 98.1% V5 (many diffs) n/a
Download CSV