Transcript: Mouse NM_010603.6

Mus musculus potassium inwardly-rectifying channel, subfamily J, member 12 (Kcnj12), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Kcnj12 (16515)
Length:
4599
CDS:
210..1799

Additional Resources:

NCBI RefSeq record:
NM_010603.6
NBCI Gene record:
Kcnj12 (16515)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010603.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069630 CGAAGAGAAGAACCAGTACAA pLKO.1 1511 CDS 100% 4.950 3.960 N Kcnj12 n/a
2 TRCN0000069629 CGGTCAGTGCAACATTGAATT pLKO.1 665 CDS 100% 0.000 0.000 N Kcnj12 n/a
3 TRCN0000069628 GCAAGACTGTTTACAAACAAA pLKO.1 2144 3UTR 100% 5.625 3.938 N Kcnj12 n/a
4 TRCN0000069631 CAACTCTTTCTGCTATGAGAA pLKO.1 1631 CDS 100% 4.950 3.465 N Kcnj12 n/a
5 TRCN0000069632 CTGGTTGTTGTTTGGCATCAT pLKO.1 797 CDS 100% 4.950 3.465 N Kcnj12 n/a
6 TRCN0000044519 GAACCAGTACAAGATTGACTA pLKO.1 1520 CDS 100% 4.950 3.465 N KCNJ12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010603.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00896 pDONR223 100% 71.7% 77.7% None (many diffs) n/a
2 ccsbBroad304_00896 pLX_304 0% 71.7% 77.7% V5 (many diffs) n/a
3 TRCN0000481122 AACCCGACGGTCGGCATGCGTTCA pLX_317 24.9% 71.7% 77.7% V5 (many diffs) n/a
Download CSV