Transcript: Mouse NM_010655.3

Mus musculus karyopherin (importin) alpha 2 (Kpna2), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Kpna2 (16647)
Length:
2071
CDS:
191..1780

Additional Resources:

NCBI RefSeq record:
NM_010655.3
NBCI Gene record:
Kpna2 (16647)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010655.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000381520 GTGCTATCCCAGCGTTTATTT pLKO_005 675 CDS 100% 15.000 21.000 N Kpna2 n/a
2 TRCN0000093515 CCGACTTAACAGGTTCAAGAA pLKO.1 226 CDS 100% 4.950 6.930 N Kpna2 n/a
3 TRCN0000093516 CGTGGGCTATAACCAACTATA pLKO.1 1383 CDS 100% 13.200 9.240 N Kpna2 n/a
4 TRCN0000381369 TACTCAAGCTGCTCGGAAATT pLKO_005 478 CDS 100% 13.200 9.240 N Kpna2 n/a
5 TRCN0000380526 TCCTCTCTAAGGCGGACTTTA pLKO_005 1344 CDS 100% 13.200 9.240 N Kpna2 n/a
6 TRCN0000093517 CCCAGCGTTTATTTCTCTCTT pLKO.1 682 CDS 100% 4.950 3.465 N Kpna2 n/a
7 TRCN0000093514 GTGTTCTCATAGATTTGTCTT pLKO.1 1827 3UTR 100% 4.950 3.465 N Kpna2 n/a
8 TRCN0000093518 CCTGGACACTTTCAAACCTTT pLKO.1 879 CDS 100% 4.950 2.970 N Kpna2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010655.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06500 pDONR223 100% 87.3% 94.1% None (many diffs) n/a
2 ccsbBroad304_06500 pLX_304 0% 87.3% 94.1% V5 (many diffs) n/a
3 TRCN0000491681 ACACTGAACAATCCAGAGAGTTCA pLX_317 19.7% 87.3% 94.1% V5 (many diffs) n/a
4 ccsbBroadEn_06499 pDONR223 100% 87.3% 94.1% None (many diffs) n/a
5 ccsbBroad304_06499 pLX_304 0% 87.3% 94.1% V5 (many diffs) n/a
6 TRCN0000466319 GCTCTTGCTCTGCGATCATTGGTA pLX_317 27.2% 87.3% 94.1% V5 (many diffs) n/a
7 ccsbBroadEn_06501 pDONR223 100% 87.3% 94.1% None (many diffs) n/a
8 ccsbBroad304_06501 pLX_304 0% 87.3% 94.1% V5 (many diffs) n/a
9 TRCN0000469404 TTATCCCTTGGCTCGCCAGAATCG pLX_317 24.8% 87.3% 94.1% V5 (many diffs) n/a
Download CSV