Transcript: Mouse NM_010688.4

Mus musculus LIM and SH3 protein 1 (Lasp1), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Lasp1 (16796)
Length:
3433
CDS:
123..914

Additional Resources:

NCBI RefSeq record:
NM_010688.4
NBCI Gene record:
Lasp1 (16796)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010688.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075566 GTGCGCTACAAGGAGGAATTT pLKO.1 372 CDS 100% 13.200 10.560 N Lasp1 n/a
2 TRCN0000075563 GCCTGGTCAATCCCTTTACTT pLKO.1 2492 3UTR 100% 5.625 4.500 N Lasp1 n/a
3 TRCN0000301417 GCCTGGTCAATCCCTTTACTT pLKO_005 2492 3UTR 100% 5.625 4.500 N Lasp1 n/a
4 TRCN0000075567 GAACTACAAGGGTTATGAGAA pLKO.1 248 CDS 100% 4.950 3.960 N Lasp1 n/a
5 TRCN0000301418 GAACTACAAGGGTTATGAGAA pLKO_005 248 CDS 100% 4.950 3.960 N Lasp1 n/a
6 TRCN0000075565 CCAGGACCAGATCAGCAATAT pLKO.1 461 CDS 100% 13.200 9.240 N Lasp1 n/a
7 TRCN0000301420 CCAGGACCAGATCAGCAATAT pLKO_005 461 CDS 100% 13.200 9.240 N Lasp1 n/a
8 TRCN0000075564 CCTTACTGCAATGCACACTAT pLKO.1 273 CDS 100% 4.950 3.465 N Lasp1 n/a
9 TRCN0000301419 CCTTACTGCAATGCACACTAT pLKO_005 273 CDS 100% 4.950 3.465 N Lasp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010688.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06516 pDONR223 100% 90.3% 95.4% None (many diffs) n/a
2 ccsbBroad304_06516 pLX_304 0% 90.3% 95.4% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000466984 AACCGCTAGTGGTACGGCGCCTCA pLX_317 57.9% 90.3% 95.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV