Transcript: Mouse NM_010768.2

Mus musculus megakaryocyte-associated tyrosine kinase (Matk), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Matk (17179)
Length:
1980
CDS:
344..1861

Additional Resources:

NCBI RefSeq record:
NM_010768.2
NBCI Gene record:
Matk (17179)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010768.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023427 GCCCTAGATTGTTCGGAGCTT pLKO.1 417 CDS 100% 2.640 3.696 N Matk n/a
2 TRCN0000363407 TCGGGTGAGCCCTAGATTGTT pLKO_005 409 CDS 100% 5.625 7.313 N Matk n/a
3 TRCN0000378621 ATCGATGAGGCCGTGTGTTTC pLKO_005 875 CDS 100% 10.800 8.640 N Matk n/a
4 TRCN0000361266 TTGTGGGAAGTCTTCTCTTAT pLKO_005 1577 CDS 100% 13.200 9.240 N Matk n/a
5 TRCN0000361265 TGTTGCTGAAGGCATGGAATA pLKO_005 1342 CDS 100% 10.800 7.560 N Matk n/a
6 TRCN0000002221 CAAGTCGGATGTCTGGAGTTT pLKO.1 1546 CDS 100% 4.950 3.465 N MATK n/a
7 TRCN0000023425 CCACGGCTTGTACATTGTCAT pLKO.1 1228 CDS 100% 4.950 3.465 N Matk n/a
8 TRCN0000023424 CGTGTGTTTCTGTAACCTGAT pLKO.1 886 CDS 100% 4.050 2.835 N Matk n/a
9 TRCN0000023426 GCTGTGAAGAATATCAAGTGT pLKO.1 1115 CDS 100% 3.000 2.100 N Matk n/a
10 TRCN0000023428 CAGTGACTTTGGCTTAGCCAA pLKO.1 1441 CDS 100% 2.640 1.848 N Matk n/a
11 TRCN0000244304 AGGGCAACCTGGTGAACTTTC pLKO_005 1263 CDS 100% 10.800 7.560 N MATK n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010768.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14694 pDONR223 0% 83.7% 87.3% None (many diffs) n/a
2 ccsbBroad304_14694 pLX_304 0% 83.7% 87.3% V5 (many diffs) n/a
3 TRCN0000471647 TCGGTCCAATATTTAGTTCTGCTT pLX_317 28.4% 83.7% 87.3% V5 (many diffs) n/a
4 TRCN0000489618 TACACCTGACTTTACCGGCATTTC pLX_317 27.9% 83.7% 87.3% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000489779 GCCGATCGCGCTTCGCGCGTGTAC pLX_317 26.7% 83.7% 87.3% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000488126 GATCCGACTCTAGGCGACTATCGT pLX_317 20% 83.6% 87.2% V5 (many diffs) n/a
Download CSV