Transcript: Mouse NM_010883.3

Mus musculus Norrie disease (pseudoglioma) (human) (Ndp), mRNA.

Source:
NCBI, updated 2017-06-10
Taxon:
Mus musculus (mouse)
Gene:
Ndp (17986)
Length:
1962
CDS:
596..991

Additional Resources:

NCBI RefSeq record:
NM_010883.3
NBCI Gene record:
Ndp (17986)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_010883.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000104967 GACACCATTATGTCGATTCTA pLKO.1 711 CDS 100% 5.625 7.875 N Ndp n/a
2 TRCN0000104969 CGATTCTATCAGTCACCCACT pLKO.1 724 CDS 100% 2.160 3.024 N Ndp n/a
3 TRCN0000104968 GTACAAATGTAGCTCAAAGAT pLKO.1 745 CDS 100% 5.625 3.938 N Ndp n/a
4 TRCN0000104966 CATGCGACTTACTGCCACTTA pLKO.1 928 CDS 100% 4.950 3.465 N Ndp n/a
5 TRCN0000104965 GCCTCTAAAGTTTCCTGGTTT pLKO.1 1418 3UTR 100% 4.950 3.465 N Ndp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_010883.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01063 pDONR223 100% 90.4% 93.9% None (many diffs) n/a
2 ccsbBroad304_01063 pLX_304 0% 90.4% 93.9% V5 (many diffs) n/a
3 TRCN0000468792 ACTTGCCCCCGTTTATGTCCGTTC pLX_317 100% 90.4% 93.9% V5 (many diffs) n/a
Download CSV