Transcript: Mouse NM_011010.2

Mus musculus olfactory marker protein (Omp), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Omp (18378)
Length:
2168
CDS:
30..521

Additional Resources:

NCBI RefSeq record:
NM_011010.2
NBCI Gene record:
Omp (18378)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000258127 CGTCTACCGCCTCGATTTCAT pLKO_005 182 CDS 100% 5.625 7.875 N Omp n/a
2 TRCN0000265325 TCGATCACTGGAACGTGGTTC pLKO_005 223 CDS 100% 4.050 5.670 N Omp n/a
3 TRCN0000251119 TCTAGCCACCCACGCTCATAT pLKO_005 1134 3UTR 100% 13.200 10.560 N Omp n/a
4 TRCN0000187857 GATCCGCAAGGTCATGTATTT pLKO.1 431 CDS 100% 13.200 9.240 N Omp n/a
5 TRCN0000251120 GATCCGCAAGGTCATGTATTT pLKO_005 431 CDS 100% 13.200 9.240 N Omp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011010.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01119 pDONR223 100% 88.5% 89.5% None (many diffs) n/a
2 ccsbBroad304_01119 pLX_304 0% 88.5% 89.5% V5 (many diffs) n/a
3 TRCN0000471404 ACGCCTGTCAATATACCCGGCATC pLX_317 77.2% 88.5% 89.5% V5 (many diffs) n/a
Download CSV