Transcript: Mouse NM_011060.4

Mus musculus peptidyl arginine deiminase, type III (Padi3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Padi3 (18601)
Length:
3068
CDS:
42..2036

Additional Resources:

NCBI RefSeq record:
NM_011060.4
NBCI Gene record:
Padi3 (18601)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011060.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101535 GCGCTGTTGATGGTTAGGAAA pLKO.1 2772 3UTR 100% 4.950 6.930 N Padi3 n/a
2 TRCN0000101539 GTGAGGAATAACACCTGCTTT pLKO.1 978 CDS 100% 4.950 6.930 N Padi3 n/a
3 TRCN0000101537 GCCCAAGATAACTGTGACCAA pLKO.1 528 CDS 100% 2.640 2.112 N Padi3 n/a
4 TRCN0000101536 CCAGAGCCTTATCAACTTTAA pLKO.1 1643 CDS 100% 13.200 9.240 N Padi3 n/a
5 TRCN0000101538 CCAAGATAACTGTGACCAATA pLKO.1 530 CDS 100% 10.800 7.560 N Padi3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011060.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03367 pDONR223 100% 84.6% 87.1% None (many diffs) n/a
2 ccsbBroad304_03367 pLX_304 0% 84.6% 87.1% V5 (many diffs) n/a
3 TRCN0000480557 TACCGAACACCAAGCTGTTATAAA pLX_317 20.8% 84.6% 87.1% V5 (many diffs) n/a
4 ccsbBroadEn_08337 pDONR223 100% 84.6% 87.1% None (many diffs) n/a
5 ccsbBroad304_08337 pLX_304 0% 84.6% 87.1% V5 (many diffs) n/a
6 TRCN0000480351 CTACTATATGGCTACCGTATCGCC pLX_317 16% 84.6% 87.1% V5 (many diffs) n/a
Download CSV