Transcript: Mouse NM_011132.2

Mus musculus polymerase (DNA directed), epsilon (Pole), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pole (18973)
Length:
7167
CDS:
70..6921

Additional Resources:

NCBI RefSeq record:
NM_011132.2
NBCI Gene record:
Pole (18973)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011132.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328840 TTCGCCCTGTGCACCATTATT pLKO_005 1504 CDS 100% 15.000 21.000 N Pole n/a
2 TRCN0000353501 TATTGCCGGAAAGCCTATAAG pLKO_005 2245 CDS 100% 13.200 18.480 N Pole n/a
3 TRCN0000328839 TTGCCCTATATGCCGTATTTC pLKO_005 361 CDS 100% 13.200 18.480 N Pole n/a
4 TRCN0000120310 GCCAACTTCAATCGCATCATT pLKO.1 5662 CDS 100% 5.625 7.875 N Pole n/a
5 TRCN0000328837 GCCAACTTCAATCGCATCATT pLKO_005 5662 CDS 100% 5.625 7.875 N Pole n/a
6 TRCN0000120308 CCGCTATATCATCTCCCGAAA pLKO.1 3297 CDS 100% 4.050 5.670 N Pole n/a
7 TRCN0000120309 CCCGTGAAGAACAGGCTAAAT pLKO.1 2201 CDS 100% 13.200 9.240 N Pole n/a
8 TRCN0000120311 CGCCATATCTACCTGTACCAT pLKO.1 4519 CDS 100% 3.000 2.100 N Pole n/a
9 TRCN0000120307 CACTTTGGTATCCCACACCTA pLKO.1 6939 3UTR 100% 2.640 1.848 N Pole n/a
10 TRCN0000328838 CACTTTGGTATCCCACACCTA pLKO_005 6939 3UTR 100% 2.640 1.848 N Pole n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011132.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11042 pDONR223 100% 13.5% 13.4% None (many diffs) n/a
2 ccsbBroad304_11042 pLX_304 0% 13.5% 13.4% V5 (many diffs) n/a
3 TRCN0000466721 CGACTGACGATCACGCATCGCGTC pLX_317 25.6% 13.5% 13.4% V5 (many diffs) n/a
Download CSV