Transcript: Mouse NM_011149.2

Mus musculus peptidylprolyl isomerase B (Ppib), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Ppib (19035)
Length:
979
CDS:
98..748

Additional Resources:

NCBI RefSeq record:
NM_011149.2
NBCI Gene record:
Ppib (19035)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011149.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000049252 GCCTTAGCTACAGGAGAGAAA pLKO.1 329 CDS 100% 4.950 6.930 N PPIB n/a
2 TRCN0000290987 GCCTTAGCTACAGGAGAGAAA pLKO_005 329 CDS 100% 4.950 6.930 N PPIB n/a
3 TRCN0000101071 CGAGTCGTCTTTGGACTCTTT pLKO.1 272 CDS 100% 0.495 0.693 N Ppib n/a
4 TRCN0000101070 CATCCCTCTAAGCAGCTGTCT pLKO.1 765 3UTR 100% 2.640 2.112 N Ppib n/a
5 TRCN0000325196 CATCCCTCTAAGCAGCTGTCT pLKO_005 765 3UTR 100% 2.640 2.112 N Ppib n/a
6 TRCN0000374831 CAGGAGGAAAGAGCATCTATG pLKO_005 435 CDS 100% 10.800 7.560 N Ppib n/a
7 TRCN0000101074 GTCACAGTCAAGGTATACTTT pLKO.1 221 CDS 100% 5.625 3.938 N Ppib n/a
8 TRCN0000325198 GTCACAGTCAAGGTATACTTT pLKO_005 221 CDS 100% 5.625 3.938 N Ppib n/a
9 TRCN0000374892 CAGCAAGTTCCATCGTGTCAT pLKO_005 367 CDS 100% 4.950 3.465 N Ppib n/a
10 TRCN0000101073 CGATAAGAAGAAGGGACCTAA pLKO.1 199 CDS 100% 4.950 3.465 N Ppib n/a
11 TRCN0000101072 GCCACTGAAGGATGTCATCAT pLKO.1 673 CDS 100% 4.950 2.970 N Ppib n/a
12 TRCN0000325197 GCCACTGAAGGATGTCATCAT pLKO_005 673 CDS 100% 4.950 2.970 N Ppib n/a
13 TRCN0000454647 TCAAGGACTTCATGATCCAAG pLKO_005 387 CDS 100% 4.050 2.025 Y Ppil1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011149.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06757 pDONR223 100% 90.1% 93.5% None (many diffs) n/a
2 ccsbBroad304_06757 pLX_304 0% 90.1% 93.5% V5 (many diffs) n/a
3 TRCN0000474430 GAGCCTGAAAGAGTTCCCCAGTGA pLX_317 60% 90.1% 93.5% V5 (many diffs) n/a
4 TRCN0000489096 ACCGTTTATCGGAGCAGTGTTCTA pLX_317 45.6% 90.1% 93.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV