Transcript: Mouse NM_011185.3

Mus musculus proteasome (prosome, macropain) subunit, beta type 1 (Psmb1), mRNA.

Source:
NCBI, updated 2017-05-14
Taxon:
Mus musculus (mouse)
Gene:
Psmb1 (19170)
Length:
1036
CDS:
15..737

Additional Resources:

NCBI RefSeq record:
NM_011185.3
NBCI Gene record:
Psmb1 (19170)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011185.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031987 GCATTCCAATAACAAGGCCAT pLKO.1 323 CDS 100% 2.160 1.728 N Psmb1 n/a
2 TRCN0000324862 GCATTCCAATAACAAGGCCAT pLKO_005 323 CDS 100% 2.160 1.728 N Psmb1 n/a
3 TRCN0000031988 CGATTGCTGCAATGCTGTCTA pLKO.1 355 CDS 100% 4.950 3.465 N Psmb1 n/a
4 TRCN0000324860 CGATTGCTGCAATGCTGTCTA pLKO_005 355 CDS 100% 4.950 3.465 N Psmb1 n/a
5 TRCN0000031986 CCATGGAGATTGTCTCACTTT pLKO.1 266 CDS 100% 4.950 2.970 N Psmb1 n/a
6 TRCN0000324777 CCATGGAGATTGTCTCACTTT pLKO_005 266 CDS 100% 4.950 2.970 N Psmb1 n/a
7 TRCN0000031985 CGGAGGTACTGTATTGGCAAT pLKO.1 119 CDS 100% 4.050 2.430 N Psmb1 n/a
8 TRCN0000324772 CGGAGGTACTGTATTGGCAAT pLKO_005 119 CDS 100% 4.050 2.430 N Psmb1 n/a
9 TRCN0000031984 CCCTTACTATGTTTACAACAT pLKO.1 401 CDS 100% 4.950 2.475 Y Psmb1 n/a
10 TRCN0000324775 CCCTTACTATGTTTACAACAT pLKO_005 401 CDS 100% 4.950 2.475 Y Psmb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011185.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01309 pDONR223 100% 85.3% 92.5% None (many diffs) n/a
2 ccsbBroad304_01309 pLX_304 0% 85.3% 92.5% V5 (many diffs) n/a
3 TRCN0000474053 AGTGAAAGAATCACCCCTATGAAC pLX_317 14.5% 85.3% 92.5% V5 (many diffs) n/a
4 ccsbBroadEn_06798 pDONR223 100% 83.8% 92.5% None (many diffs) n/a
5 ccsbBroad304_06798 pLX_304 0% 83.8% 92.5% V5 (many diffs) n/a
6 TRCN0000470295 CCACAGGCCTCTAGATGTACTACA pLX_317 66.4% 83.8% 92.5% V5 (many diffs) n/a
Download CSV