Transcript: Mouse NM_011188.3

Mus musculus proteasome (prosome, macropain) 26S subunit, ATPase 2 (Psmc2), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Psmc2 (19181)
Length:
1782
CDS:
275..1702

Additional Resources:

NCBI RefSeq record:
NM_011188.3
NBCI Gene record:
Psmc2 (19181)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011188.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000350066 CTTACGGCCAAAGTACTTATT pLKO_005 504 CDS 100% 13.200 18.480 N Psmc2 n/a
2 TRCN0000065618 GCTTGCTTCATTCGAGTTATT pLKO.1 1103 CDS 100% 13.200 18.480 N Psmc2 n/a
3 TRCN0000317656 GCTTGCTTCATTCGAGTTATT pLKO_005 1103 CDS 100% 13.200 18.480 N Psmc2 n/a
4 TRCN0000065621 CGAACGCACATCTTTAAGATT pLKO.1 1451 CDS 100% 5.625 7.875 N Psmc2 n/a
5 TRCN0000317657 CGAACGCACATCTTTAAGATT pLKO_005 1451 CDS 100% 5.625 7.875 N Psmc2 n/a
6 TRCN0000065622 CGGTGTGGACAGAAATAAATA pLKO.1 820 CDS 100% 15.000 10.500 N Psmc2 n/a
7 TRCN0000317736 CGGTGTGGACAGAAATAAATA pLKO_005 820 CDS 100% 15.000 10.500 N Psmc2 n/a
8 TRCN0000350020 TAATGAGCTCACTGGTATTAA pLKO_005 577 CDS 100% 15.000 10.500 N Psmc2 n/a
9 TRCN0000065619 CCATCCAGAGAGGTTTGTTAA pLKO.1 988 CDS 100% 13.200 9.240 N Psmc2 n/a
10 TRCN0000065620 GCTACAGAGAAGGACTTCTTA pLKO.1 1610 CDS 100% 5.625 3.938 N Psmc2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011188.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01314 pDONR223 100% 80.9% 90.9% None (many diffs) n/a
2 ccsbBroad304_01314 pLX_304 0% 80.9% 90.9% V5 (many diffs) n/a
3 TRCN0000472008 CAGCATATTCAAAGCTATCCCTTC pLX_317 37.8% 80.9% 90.9% V5 (many diffs) n/a
Download CSV