Transcript: Mouse NM_011192.3

Mus musculus proteaseome (prosome, macropain) activator subunit 3 (PA28 gamma, Ki) (Psme3), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Psme3 (19192)
Length:
2620
CDS:
197..961

Additional Resources:

NCBI RefSeq record:
NM_011192.3
NBCI Gene record:
Psme3 (19192)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011192.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348564 CATACTGGCACAAGCGTAATT pLKO_005 1224 3UTR 100% 13.200 18.480 N Psme3 n/a
2 TRCN0000058071 GAGAAATGTAACACGGTCAAA pLKO.1 587 CDS 100% 4.950 6.930 N PSME3 n/a
3 TRCN0000066558 CGAGAAATGTAACACGGTCAA pLKO.1 586 CDS 100% 4.050 5.670 N Psme3 n/a
4 TRCN0000066562 AGAGCCAAATTGGTTTCTAAA pLKO.1 752 CDS 100% 13.200 9.240 N Psme3 n/a
5 TRCN0000335594 AGAGCCAAATTGGTTTCTAAA pLKO_005 752 CDS 100% 13.200 9.240 N Psme3 n/a
6 TRCN0000066559 GCAGAAGACTTGGTGGCAAAT pLKO.1 272 CDS 100% 10.800 7.560 N Psme3 n/a
7 TRCN0000335512 GCAGAAGACTTGGTGGCAAAT pLKO_005 272 CDS 100% 10.800 7.560 N Psme3 n/a
8 TRCN0000066560 CGCACTGTCACAGAGATTGAT pLKO.1 806 CDS 100% 5.625 3.938 N Psme3 n/a
9 TRCN0000335595 CGCACTGTCACAGAGATTGAT pLKO_005 806 CDS 100% 5.625 3.938 N Psme3 n/a
10 TRCN0000066561 CCAAAGAAGTTACTAGAACTT pLKO.1 299 CDS 100% 0.495 0.347 N Psme3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011192.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02348 pDONR223 100% 94% 100% None (many diffs) n/a
2 ccsbBroad304_02348 pLX_304 0% 94% 100% V5 (many diffs) n/a
Download CSV