Transcript: Mouse NM_011196.2

Mus musculus prostaglandin E receptor 3 (subtype EP3) (Ptger3), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ptger3 (19218)
Length:
2090
CDS:
127..1215

Additional Resources:

NCBI RefSeq record:
NM_011196.2
NBCI Gene record:
Ptger3 (19218)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011196.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221811 CGGGCTAACCATGACAGTGTT pLKO.1 456 CDS 100% 4.950 3.960 N Ptger3 n/a
2 TRCN0000428530 GAGCAAATGTTCATCTAATAA pLKO_005 1529 3UTR 100% 15.000 10.500 N Ptger3 n/a
3 TRCN0000413129 GACAAGCTTTCTTAGGATAAT pLKO_005 1284 3UTR 100% 13.200 9.240 N Ptger3 n/a
4 TRCN0000417846 GATAGTCTGACTCTTCTAAAT pLKO_005 1456 3UTR 100% 13.200 9.240 N Ptger3 n/a
5 TRCN0000427586 GGAGTGCAATTCCTTTCTAAT pLKO_005 1026 CDS 100% 13.200 9.240 N Ptger3 n/a
6 TRCN0000446911 CAGCAACCTGTCAAGTACTAC pLKO_005 168 CDS 100% 4.950 3.465 N Ptger3 n/a
7 TRCN0000221810 CCTGGGTTTATCTGCTGCTAA pLKO.1 1085 CDS 100% 4.950 3.465 N Ptger3 n/a
8 TRCN0000221809 GCCGCTATTGATAATGATGTT pLKO.1 945 CDS 100% 4.950 3.465 N Ptger3 n/a
9 TRCN0000221808 GCTCCTCAGTAATTCAGGAAT pLKO.1 1698 3UTR 100% 4.950 3.465 N Ptger3 n/a
10 TRCN0000221812 CTGCTAAGAAAGATCCTTCTT pLKO.1 1099 CDS 100% 0.495 0.297 N Ptger3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011196.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.