Transcript: Mouse NM_011198.4

Mus musculus prostaglandin-endoperoxide synthase 2 (Ptgs2), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Ptgs2 (19225)
Length:
4460
CDS:
194..2008

Additional Resources:

NCBI RefSeq record:
NM_011198.4
NBCI Gene record:
Ptgs2 (19225)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011198.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000067941 CCGTACACATCATTTGAAGAA pLKO.1 1571 CDS 100% 4.950 6.930 N Ptgs2 n/a
2 TRCN0000067942 CGGACTGGATTCTATGGTGAA pLKO.1 329 CDS 100% 4.050 3.240 N Ptgs2 n/a
3 TRCN0000067938 GCACAGGATTTGACCAGTATA pLKO.1 294 CDS 100% 13.200 9.240 N Ptgs2 n/a
4 TRCN0000067939 CCTCGTCCAGATGCTATCTTT pLKO.1 1685 CDS 100% 5.625 3.938 N Ptgs2 n/a
5 TRCN0000067940 GCTGTTCCAATCCATGTCAAA pLKO.1 255 CDS 100% 4.950 3.465 N Ptgs2 n/a
6 TRCN0000045537 CCATTCTCCTTGAAAGGACTT pLKO.1 1733 CDS 100% 4.050 2.835 N PTGS2 n/a
7 TRCN0000286970 CCATTCTCCTTGAAAGGACTT pLKO_005 1733 CDS 100% 4.050 2.835 N PTGS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011198.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01336 pDONR223 100% 85% 86.7% None (many diffs) n/a
2 ccsbBroad304_01336 pLX_304 0% 85% 86.7% V5 (many diffs) n/a
3 TRCN0000467557 CCTCCCGGGATCTAAAGTTCCACG pLX_317 18% 85% 86.7% V5 (many diffs) n/a
Download CSV