Transcript: Mouse NM_011228.2

Mus musculus RAB33A, member RAS oncogene family (Rab33a), mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Rab33a (19337)
Length:
1183
CDS:
317..1030

Additional Resources:

NCBI RefSeq record:
NM_011228.2
NBCI Gene record:
Rab33a (19337)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380645 AGTACGTGCAGATTCGCATTT pLKO_005 405 CDS 100% 10.800 15.120 N Rab33a n/a
2 TRCN0000100728 CAGTACGTGCAGATTCGCATT pLKO.1 404 CDS 100% 4.050 5.670 N Rab33a n/a
3 TRCN0000047773 CCTCCAACTTAGCCCTGAAAT pLKO.1 801 CDS 100% 13.200 9.240 N RAB33A n/a
4 TRCN0000100727 CTCCAACTTAGCCCTGAAATT pLKO.1 802 CDS 100% 13.200 9.240 N Rab33a n/a
5 TRCN0000100726 GACCTCCTTCACCAACTTAAA pLKO.1 682 CDS 100% 13.200 9.240 N Rab33a n/a
6 TRCN0000381085 GCCGACTTAAGGCCCAGAAAT pLKO_005 915 CDS 100% 13.200 9.240 N Rab33a n/a
7 TRCN0000380603 CAAGGTGCTTGTGGGTAACAA pLKO_005 751 CDS 100% 5.625 3.938 N Rab33a n/a
8 TRCN0000100725 GCTCATAACATGCTCTTGTTT pLKO.1 830 CDS 100% 5.625 3.938 N Rab33a n/a
9 TRCN0000381501 GAAATTTGCTGACGCTCATAA pLKO_005 817 CDS 100% 13.200 7.920 N Rab33a n/a
10 TRCN0000379653 TGACCTCCTTCACCAACTTAA pLKO_005 681 CDS 100% 13.200 7.920 N Rab33a n/a
11 TRCN0000381701 GGCCAAGAACGCTTCCGTAAA pLKO_005 596 CDS 100% 10.800 6.480 N Rab33a n/a
12 TRCN0000047777 GAGCATTACTACCGCAACGTA pLKO.1 626 CDS 100% 3.000 4.200 N RAB33A n/a
13 TRCN0000178741 CACACACATACACACACACAA pLKO.1 199 5UTR 100% 4.950 2.475 Y Cstad n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011228.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02149 pDONR223 100% 92.2% 98.3% None (many diffs) n/a
2 ccsbBroad304_02149 pLX_304 0% 92.2% 98.3% V5 (many diffs) n/a
3 TRCN0000470865 GCTAGCCCATGTTGTCTCGCCTAG pLX_317 60.3% 92.2% 98.3% V5 (many diffs) n/a
4 TRCN0000489665 TTTTACCGAGTGAGAGTTTGTCTA pLX_317 60% 92.2% 98.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV