Transcript: Mouse NM_011326.3

Mus musculus sodium channel, nonvoltage-gated 1 gamma (Scnn1g), mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Mus musculus (mouse)
Gene:
Scnn1g (20278)
Length:
3016
CDS:
98..2065

Additional Resources:

NCBI RefSeq record:
NM_011326.3
NBCI Gene record:
Scnn1g (20278)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011326.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000069141 GCTTCTAATGTCATGCACGTT pLKO.1 680 CDS 100% 2.640 3.696 N Scnn1g n/a
2 TRCN0000069138 CCCGTCACAAACATCTACAAT pLKO.1 1253 CDS 100% 5.625 4.500 N Scnn1g n/a
3 TRCN0000069140 CGAAGTCTTCTTCATTGATTT pLKO.1 1765 CDS 100% 13.200 9.240 N Scnn1g n/a
4 TRCN0000069142 CGTCTGTGTCATCGAAATCAT pLKO.1 1744 CDS 100% 5.625 3.938 N Scnn1g n/a
5 TRCN0000044601 CCCAGCCAACAGTATTGAGAT pLKO.1 1672 CDS 100% 4.950 3.465 N SCNN1G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011326.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01492 pDONR223 100% 83.8% 85.4% None (many diffs) n/a
2 ccsbBroad304_01492 pLX_304 0% 83.8% 85.4% V5 (many diffs) n/a
3 TRCN0000479142 CGTCCACGGCTTCAGTATCCTTCA pLX_317 21.5% 83.8% 85.4% V5 (many diffs) n/a
Download CSV