Transcript: Mouse NM_011343.3

Mus musculus SEC61, gamma subunit (Sec61g), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Sec61g (20335)
Length:
754
CDS:
292..594

Additional Resources:

NCBI RefSeq record:
NM_011343.3
NBCI Gene record:
Sec61g (20335)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011343.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000100517 ACTGATCCATATACCCATTAA pLKO.1 552 CDS 100% 13.200 6.600 Y Sec61g n/a
2 TRCN0000334191 ACTGATCCATATACCCATTAA pLKO_005 552 CDS 100% 13.200 6.600 Y Sec61g n/a
3 TRCN0000374443 ACAAACATGGATCAGGTAATG pLKO_005 382 CDS 100% 10.800 5.400 Y Sec61g n/a
4 TRCN0000380600 TCAATCCGCCATCCAACAAAC pLKO_005 367 CDS 100% 10.800 5.400 Y Sec61g n/a
5 TRCN0000100519 AGGACTCAATTCGGCTGGTTA pLKO.1 434 CDS 100% 4.950 2.475 Y Sec61g n/a
6 TRCN0000334190 AGGACTCAATTCGGCTGGTTA pLKO_005 434 CDS 100% 4.950 2.475 Y Sec61g n/a
7 TRCN0000100518 CATGGGATTCATTGGCTTCTT pLKO.1 525 CDS 100% 4.950 2.475 Y Sec61g n/a
8 TRCN0000334257 CATGGGATTCATTGGCTTCTT pLKO_005 525 CDS 100% 4.950 2.475 Y Sec61g n/a
9 TRCN0000381569 GATGCACCAAACCCGACAGAA pLKO_005 458 CDS 100% 4.950 2.475 Y Sec61g n/a
10 TRCN0000100516 GCAGTTTGTAAAGGACTCAAT pLKO.1 423 CDS 100% 4.950 2.475 Y Sec61g n/a
11 TRCN0000100515 CCTTCTCATCATGGGACGAGT pLKO.1 597 3UTR 100% 2.640 1.320 Y Sec61g n/a
12 TRCN0000273514 ATTCCAGAAGATTGCCATGGC pLKO_005 483 CDS 100% 2.160 1.080 Y SEC61G n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011343.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02776 pDONR223 100% 62.6% 68% None (many diffs) n/a
2 ccsbBroad304_02776 pLX_304 0% 62.6% 68% V5 (many diffs) n/a
3 TRCN0000466863 AATTTTGGCGTTCCAACTTCGCGC pLX_317 100% 62.6% 68% V5 (many diffs) n/a
Download CSV