Transcript: Mouse NM_011390.2

Mus musculus solute carrier family 12, member 7 (Slc12a7), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Slc12a7 (20499)
Length:
5131
CDS:
71..3322

Additional Resources:

NCBI RefSeq record:
NM_011390.2
NBCI Gene record:
Slc12a7 (20499)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011390.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000351058 AGGTGTAGTCCTGCGAGATAA pLKO_005 1504 CDS 100% 13.200 9.240 N Slc12a7 n/a
2 TRCN0000068368 CGTGACTACATCTTTCATTTA pLKO.1 1447 CDS 100% 13.200 9.240 N Slc12a7 n/a
3 TRCN0000327500 CGTGACTACATCTTTCATTTA pLKO_005 1447 CDS 100% 13.200 9.240 N Slc12a7 n/a
4 TRCN0000068372 GCTTGGAAGGAGGCAGATAAT pLKO.1 2462 CDS 100% 13.200 9.240 N Slc12a7 n/a
5 TRCN0000379346 TGAACAAGCTGGCCAACTATA pLKO_005 327 CDS 100% 13.200 9.240 N Slc12a7 n/a
6 TRCN0000375745 TTGTCGGCAATGGTAGGTATA pLKO_005 3585 3UTR 100% 10.800 7.560 N Slc12a7 n/a
7 TRCN0000068369 CGGCTGCATCTACAAGTACAT pLKO.1 2005 CDS 100% 4.950 3.465 N Slc12a7 n/a
8 TRCN0000363561 CGGCTGCATCTACAAGTACAT pLKO_005 2005 CDS 100% 4.950 3.465 N Slc12a7 n/a
9 TRCN0000068370 GCATCTACTTCCCGTCTGTAA pLKO.1 1344 CDS 100% 4.950 3.465 N Slc12a7 n/a
10 TRCN0000068371 TGGACGAAAGAGAAACTCATT pLKO.1 3011 CDS 100% 4.950 2.970 N Slc12a7 n/a
11 TRCN0000327498 TGGACGAAAGAGAAACTCATT pLKO_005 3011 CDS 100% 4.950 2.970 N Slc12a7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011390.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14053 pDONR223 100% 20.3% 19.5% None (many diffs) n/a
2 ccsbBroad304_14053 pLX_304 0% 20.3% 19.5% V5 (many diffs) n/a
3 TRCN0000466206 CTACACTCGTTGTGTCCGATGGTT pLX_317 42.2% 20.3% 19.5% V5 (many diffs) n/a
Download CSV