Transcript: Mouse NM_011416.2

Mus musculus SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 2 (Smarca2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Smarca2 (67155)
Length:
5831
CDS:
111..4862

Additional Resources:

NCBI RefSeq record:
NM_011416.2
NBCI Gene record:
Smarca2 (67155)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011416.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071398 GCCTCAAAGATTCAAAGATTA pLKO.1 5133 3UTR 100% 13.200 9.240 N Smarca2 n/a
2 TRCN0000331776 GCCTCAAAGATTCAAAGATTA pLKO_005 5133 3UTR 100% 13.200 9.240 N Smarca2 n/a
3 TRCN0000358828 GGCCATCGAAGACGGCAATTT pLKO_005 4124 CDS 100% 13.200 9.240 N SMARCA2 n/a
4 TRCN0000071401 GCTGAGAAGTTGTCACCAAAT pLKO.1 4260 CDS 100% 10.800 7.560 N Smarca2 n/a
5 TRCN0000301886 GCTGAGAAGTTGTCACCAAAT pLKO_005 4260 CDS 100% 10.800 7.560 N Smarca2 n/a
6 TRCN0000071400 CCTGACTACTTACGAGTACAT pLKO.1 2621 CDS 100% 4.950 3.465 N Smarca2 n/a
7 TRCN0000071399 GCCATCATTGATACTGTGATA pLKO.1 4308 CDS 100% 4.950 3.465 N Smarca2 n/a
8 TRCN0000301978 GCCATCATTGATACTGTGATA pLKO_005 4308 CDS 100% 4.950 3.465 N Smarca2 n/a
9 TRCN0000071402 GCCCAAATTGAGAGCGACTAA pLKO.1 3320 CDS 100% 4.950 3.465 N Smarca2 n/a
10 TRCN0000301951 GCCCAAATTGAGAGCGACTAA pLKO_005 3320 CDS 100% 4.950 3.465 N Smarca2 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5068 3UTR 100% 4.950 2.475 Y KAAG1 n/a
12 TRCN0000150618 GAAGAGGAAGAAGATGATGAT pLKO.1 4644 CDS 100% 4.950 2.475 Y SAMD1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011416.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11145 pDONR223 100% 6.6% 6.9% None (many diffs) n/a
2 ccsbBroad304_11145 pLX_304 0% 6.6% 6.9% V5 (many diffs) n/a
Download CSV