Transcript: Mouse NM_011499.3

Mus musculus serine/threonine kinase receptor associated protein (Strap), mRNA.

Source:
NCBI, updated 2017-05-20
Taxon:
Mus musculus (mouse)
Gene:
Strap (20901)
Length:
2644
CDS:
274..1326

Additional Resources:

NCBI RefSeq record:
NM_011499.3
NBCI Gene record:
Strap (20901)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011499.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000088837 GTAAGTCTGGAGCCAATTAAA pLKO.1 907 CDS 100% 15.000 21.000 N Strap n/a
2 TRCN0000324154 GTAAGTCTGGAGCCAATTAAA pLKO_005 907 CDS 100% 15.000 21.000 N Strap n/a
3 TRCN0000088833 GCCAACTTACAATCTCCATTT pLKO.1 1569 3UTR 100% 10.800 15.120 N Strap n/a
4 TRCN0000324155 GCCAACTTACAATCTCCATTT pLKO_005 1569 3UTR 100% 10.800 15.120 N Strap n/a
5 TRCN0000088835 GCAAAGCCAAAGATCGGATTT pLKO.1 1219 CDS 100% 10.800 7.560 N Strap n/a
6 TRCN0000353910 GCAAAGCCAAAGATCGGATTT pLKO_005 1219 CDS 100% 10.800 7.560 N Strap n/a
7 TRCN0000088836 GCAGTAAGTCTGGAGCCAATT pLKO.1 904 CDS 100% 10.800 7.560 N Strap n/a
8 TRCN0000088834 CGCATATATGACTTGAACAAA pLKO.1 646 CDS 100% 5.625 3.938 N Strap n/a
9 TRCN0000324156 CGCATATATGACTTGAACAAA pLKO_005 646 CDS 100% 5.625 3.938 N Strap n/a
10 TRCN0000060466 TGGGTCATAAAGGTGCTGTTT pLKO.1 440 CDS 100% 4.950 3.465 N STRAP n/a
11 TRCN0000060465 CCTGAAGCAGAACCTAAGGAA pLKO.1 667 CDS 100% 3.000 2.100 N STRAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011499.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02641 pDONR223 100% 90.6% 97.7% None (many diffs) n/a
2 ccsbBroad304_02641 pLX_304 0% 90.6% 97.7% V5 (many diffs) n/a
3 TRCN0000467404 TGCCATGCGGCTGGGATGGCTATC pLX_317 45.1% 90.6% 97.7% V5 (many diffs) n/a
Download CSV