Transcript: Mouse NM_011590.2

Mus musculus translocase of inner mitochondrial membrane 17a (Timm17a), mRNA.

Source:
NCBI, updated 2017-05-13
Taxon:
Mus musculus (mouse)
Gene:
Timm17a (21854)
Length:
917
CDS:
19..534

Additional Resources:

NCBI RefSeq record:
NM_011590.2
NBCI Gene record:
Timm17a (21854)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000114224 CGGTGCCTTAACAGGAGCCAT pLKO.1 303 CDS 100% 0.880 1.232 N Timm17a n/a
2 TRCN0000324089 CGGTGCCTTAACAGGAGCCAT pLKO_005 303 CDS 100% 0.880 1.232 N Timm17a n/a
3 TRCN0000114223 CGAGGAAGTTTGACAGCTATT pLKO.1 163 CDS 100% 10.800 8.640 N Timm17a n/a
4 TRCN0000353906 CGAGGAAGTTTGACAGCTATT pLKO_005 163 CDS 100% 10.800 8.640 N Timm17a n/a
5 TRCN0000114221 CGGGCCATAAAGAGACATTTA pLKO.1 643 3UTR 100% 13.200 9.240 N Timm17a n/a
6 TRCN0000324148 CGGGCCATAAAGAGACATTTA pLKO_005 643 3UTR 100% 13.200 9.240 N Timm17a n/a
7 TRCN0000114222 GCGGCATTCTCCTAGCTTTAA pLKO.1 374 CDS 100% 13.200 9.240 N Timm17a n/a
8 TRCN0000324147 GCGGCATTCTCCTAGCTTTAA pLKO_005 374 CDS 100% 13.200 9.240 N Timm17a n/a
9 TRCN0000114225 CCAGTGGGAATAAACCACAGA pLKO.1 139 CDS 100% 2.640 1.848 N Timm17a n/a
10 TRCN0000324090 CCAGTGGGAATAAACCACAGA pLKO_005 139 CDS 100% 2.640 1.848 N Timm17a n/a
11 TRCN0000146561 CTTTAATTGAAGGAGCTGGTA pLKO.1 389 CDS 100% 2.640 1.848 N TIMM17A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011590.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02434 pDONR223 100% 89% 95.9% None (many diffs) n/a
2 ccsbBroad304_02434 pLX_304 0% 89% 95.9% V5 (many diffs) n/a
3 TRCN0000471977 ATGACTGTGTTAGGCGGCTCACGG pLX_317 85.1% 89% 95.9% V5 (many diffs) n/a
Download CSV