Transcript: Mouse NM_011595.2

Mus musculus tissue inhibitor of metalloproteinase 3 (Timp3), mRNA.

Source:
NCBI, updated 2017-04-30
Taxon:
Mus musculus (mouse)
Gene:
Timp3 (21859)
Length:
4681
CDS:
443..1078

Additional Resources:

NCBI RefSeq record:
NM_011595.2
NBCI Gene record:
Timp3 (21859)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011595.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071941 CACTCTGGTCTACACTATTAA pLKO.1 616 CDS 100% 15.000 12.000 N Timp3 n/a
2 TRCN0000071940 GCGCGTGTATGAAGGCAAGAT pLKO.1 760 CDS 100% 4.950 3.960 N Timp3 n/a
3 TRCN0000324755 GCGCGTGTATGAAGGCAAGAT pLKO_005 760 CDS 100% 4.950 3.960 N Timp3 n/a
4 TRCN0000071942 GACCGACATGCTCTCCAATTT pLKO.1 937 CDS 100% 13.200 9.240 N Timp3 n/a
5 TRCN0000324757 GACCGACATGCTCTCCAATTT pLKO_005 937 CDS 100% 13.200 9.240 N Timp3 n/a
6 TRCN0000071938 CCTGCTACTACTTGCCTTGTT pLKO.1 888 CDS 100% 4.950 3.465 N Timp3 n/a
7 TRCN0000324689 CCTGCTACTACTTGCCTTGTT pLKO_005 888 CDS 100% 4.950 3.465 N Timp3 n/a
8 TRCN0000071939 CCTGGGTTGCAATTGCAAGAT pLKO.1 862 CDS 100% 4.950 3.465 N Timp3 n/a
9 TRCN0000324754 CCTGGGTTGCAATTGCAAGAT pLKO_005 862 CDS 100% 4.950 3.465 N Timp3 n/a
10 TRCN0000052415 GATGAAGATGTACCGAGGCTT pLKO.1 640 CDS 100% 2.640 1.848 N TIMP3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011595.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01673 pDONR223 100% 89.7% 96.2% None (many diffs) n/a
2 ccsbBroad304_01673 pLX_304 0% 89.7% 96.2% V5 (many diffs) n/a
3 TRCN0000470355 AAGTCCCTTATCAGGAATCAGAAG pLX_317 49% 89.7% 96.2% V5 (many diffs) n/a
Download CSV