Transcript: Mouse NM_011716.2

Mus musculus wolframin ER transmembrane glycoprotein (Wfs1), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Wfs1 (22393)
Length:
3564
CDS:
123..2795

Additional Resources:

NCBI RefSeq record:
NM_011716.2
NBCI Gene record:
Wfs1 (22393)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011716.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000248038 AGAAGTTTGACCGCTACAAAT pLKO_005 2431 CDS 100% 13.200 18.480 N Wfs1 n/a
2 TRCN0000248037 ATGCCGAGTGTCATAAGAAAT pLKO_005 3023 3UTR 100% 13.200 18.480 N Wfs1 n/a
3 TRCN0000248039 AGTACGCCAAGGGCATCATTC pLKO_005 883 CDS 100% 10.800 15.120 N Wfs1 n/a
4 TRCN0000248036 ACGCCATCATGGAGATCAAAG pLKO_005 1009 CDS 100% 10.800 7.560 N Wfs1 n/a
5 TRCN0000248035 TCCTACTGTCAGTCGTCTTTG pLKO_005 1351 CDS 100% 10.800 7.560 N Wfs1 n/a
6 TRCN0000364299 CCTACCTGGTGTGCTTCATGT pLKO_005 1726 CDS 100% 4.950 3.465 N WFS1 n/a
7 TRCN0000063847 CGACTTCTTCGCCTTCTTCAT pLKO.1 1142 CDS 100% 4.950 3.465 N WFS1 n/a
8 TRCN0000175669 GAAAGGCATCACTTCTGAGAA pLKO.1 581 CDS 100% 4.950 3.465 N Wfs1 n/a
9 TRCN0000194618 GCCAACGATGCAGATGAAGAA pLKO.1 465 CDS 100% 4.950 3.465 N Wfs1 n/a
10 TRCN0000176223 GTTTGCCTTCGACTTCTTCTT pLKO.1 2750 CDS 100% 4.950 3.465 N Wfs1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011716.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.