Transcript: Mouse NM_011719.4

Mus musculus wingless-type MMTV integration site family, member 9B (Wnt9b), mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Wnt9b (22412)
Length:
4519
CDS:
53..1132

Additional Resources:

NCBI RefSeq record:
NM_011719.4
NBCI Gene record:
Wnt9b (22412)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011719.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071851 CGTGTATACCTGCAAGCGCTA pLKO.1 1111 CDS 100% 2.160 1.728 N Wnt9b n/a
2 TRCN0000071849 GAAGCAGTGTGACCTACTGAA pLKO.1 214 CDS 100% 4.950 3.465 N Wnt9b n/a
3 TRCN0000071848 GTGTGGTGACAATCTGAAGTA pLKO.1 541 CDS 100% 4.950 3.465 N Wnt9b n/a
4 TRCN0000071850 CAGGTGCTGAAGCTACGCTAT pLKO.1 764 CDS 100% 4.050 2.835 N Wnt9b n/a
5 TRCN0000062070 CGTGGGCATCAAGGCTGTGAA pLKO.1 646 CDS 100% 1.650 1.155 N WNT9B n/a
6 TRCN0000071852 ACATGGAAGATTCTCCCAGCT pLKO.1 906 CDS 100% 2.160 1.296 N Wnt9b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011719.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11221 pDONR223 100% 76.2% 77.6% None (many diffs) n/a
2 ccsbBroad304_11221 pLX_304 0% 76.2% 77.6% V5 (many diffs) n/a
3 TRCN0000467321 TTGGCTGTAACTCGGGGTGTTTGC pLX_317 37.9% 76.2% 77.6% V5 (many diffs) n/a
Download CSV