Transcript: Mouse NM_011782.2

Mus musculus a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 5 (aggrecanase-2) (Adamts5), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Adamts5 (23794)
Length:
8104
CDS:
859..3651

Additional Resources:

NCBI RefSeq record:
NM_011782.2
NBCI Gene record:
Adamts5 (23794)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032066 CGAGAGGATTTATGTGGGCAT pLKO.1 1957 CDS 100% 2.160 1.728 N Adamts5 n/a
2 TRCN0000032064 GCAGAGTATGAACGAATTTAT pLKO.1 1384 CDS 100% 15.000 10.500 N Adamts5 n/a
3 TRCN0000032065 GCCCACCCAATGGTAAATCTT pLKO.1 2720 CDS 100% 5.625 3.938 N Adamts5 n/a
4 TRCN0000050494 CCAGACTAGATTCACTGCCTA pLKO.1 3159 CDS 100% 2.640 1.848 N ADAMTS5 n/a
5 TRCN0000032067 CGAGTACCTTATCAATGGCAA pLKO.1 3204 CDS 100% 2.640 1.848 N Adamts5 n/a
6 TRCN0000050495 GCCCACCCAATGGTAAATCAT pLKO.1 2720 CDS 100% 5.625 3.938 N ADAMTS5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011782.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07748 pDONR223 100% 85% 89.5% None (many diffs) n/a
2 ccsbBroad304_07748 pLX_304 0% 85% 89.5% V5 (many diffs) n/a
3 TRCN0000476675 AACGGAAAATCCTTTTAAACAAAA pLX_317 13.1% 85% 89.5% V5 (many diffs) n/a
Download CSV