Transcript: Mouse NM_011891.4

Mus musculus sarcoglycan, delta (dystrophin-associated glycoprotein) (Sgcd), mRNA.

Source:
NCBI, updated 2017-05-28
Taxon:
Mus musculus (mouse)
Gene:
Sgcd (24052)
Length:
1399
CDS:
50..919

Additional Resources:

NCBI RefSeq record:
NM_011891.4
NBCI Gene record:
Sgcd (24052)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011891.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098388 CCCGACCAGGTAATGCCCTAT pLKO.1 333 CDS 100% 1.350 1.080 N Sgcd n/a
2 TRCN0000098385 CCCATCATCCACATGACAGAA pLKO.1 1202 3UTR 100% 4.950 3.465 N Sgcd n/a
3 TRCN0000098389 GAACTTCACAATTGATGGAAT pLKO.1 226 CDS 100% 4.950 3.465 N Sgcd n/a
4 TRCN0000098386 GCTGAGAGATTGAGAGTCTTA pLKO.1 527 CDS 100% 4.950 3.465 N Sgcd n/a
5 TRCN0000098387 CCAAATCCATAGAAACACCTA pLKO.1 570 CDS 100% 2.640 1.848 N Sgcd n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011891.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06941 pDONR223 100% 90.1% 94.1% None (many diffs) n/a
2 ccsbBroad304_06941 pLX_304 0% 90.1% 94.1% V5 (many diffs) n/a
3 TRCN0000474344 CATTGCGAATTACTTGTACTAGAC pLX_317 54.8% 90.1% 94.1% V5 (many diffs) n/a
Download CSV