Transcript: Mouse NM_011915.2

Mus musculus Wnt inhibitory factor 1 (Wif1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Wif1 (24117)
Length:
2242
CDS:
340..1479

Additional Resources:

NCBI RefSeq record:
NM_011915.2
NBCI Gene record:
Wif1 (24117)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011915.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000089191 GCTAGAGTGCTCATAGGATTT pLKO.1 472 CDS 100% 10.800 15.120 N Wif1 n/a
2 TRCN0000089188 GCAGCGTTTAAGCTACAGTAT pLKO.1 1885 3UTR 100% 4.950 6.930 N Wif1 n/a
3 TRCN0000089192 GCACGGCAGACACTGCAATAA pLKO.1 1335 CDS 100% 13.200 10.560 N Wif1 n/a
4 TRCN0000446274 GGGATCCACCTGAATCCAATT pLKO_005 1448 CDS 100% 10.800 7.560 N Wif1 n/a
5 TRCN0000419666 GTGTCTAGCATGATGGTATAG pLKO_005 1659 3UTR 100% 10.800 7.560 N Wif1 n/a
6 TRCN0000089190 CCCTGGATTCTACGGTGTCAA pLKO.1 1038 CDS 100% 4.950 3.465 N Wif1 n/a
7 TRCN0000089189 GCCAGCCATTCCTGTCAATAT pLKO.1 570 CDS 100% 13.200 7.920 N Wif1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011915.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07769 pDONR223 100% 88.7% 93.9% None (many diffs) n/a
2 ccsbBroad304_07769 pLX_304 0% 88.7% 93.9% V5 (many diffs) n/a
3 TRCN0000473849 ACTAGTTACCCCACAGTGTTATTG pLX_317 47.1% 88.7% 93.9% V5 (many diffs) n/a
Download CSV