Transcript: Mouse NM_011920.3

Mus musculus ATP-binding cassette, sub-family G (WHITE), member 2 (Abcg2), mRNA.

Source:
NCBI, updated 2017-06-18
Taxon:
Mus musculus (mouse)
Gene:
Abcg2 (26357)
Length:
2493
CDS:
457..2430

Additional Resources:

NCBI RefSeq record:
NM_011920.3
NBCI Gene record:
Abcg2 (26357)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011920.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110806 CCCTGGCTTGTATGATTATTA pLKO.1 2357 CDS 100% 15.000 10.500 N Abcg2 n/a
2 TRCN0000325470 CCCTGGCTTGTATGATTATTA pLKO_005 2357 CDS 100% 15.000 10.500 N Abcg2 n/a
3 TRCN0000110805 GCCTCGGTATTCCATCTTTAA pLKO.1 1185 CDS 100% 13.200 9.240 N Abcg2 n/a
4 TRCN0000325471 GCCTCGGTATTCCATCTTTAA pLKO_005 1185 CDS 100% 13.200 9.240 N Abcg2 n/a
5 TRCN0000110808 GCCAGTCTATGTTACCTCTTT pLKO.1 1554 CDS 100% 4.950 3.465 N Abcg2 n/a
6 TRCN0000325480 GCCAGTCTATGTTACCTCTTT pLKO_005 1554 CDS 100% 4.950 3.465 N Abcg2 n/a
7 TRCN0000110809 TCAGGTTATGTGGTTCAAGAT pLKO.1 814 CDS 100% 4.950 3.465 N Abcg2 n/a
8 TRCN0000325502 TCAGGTTATGTGGTTCAAGAT pLKO_005 814 CDS 100% 4.950 3.465 N Abcg2 n/a
9 TRCN0000110807 CCAAAGGGATTATCTGGAGAT pLKO.1 748 CDS 100% 4.050 2.835 N Abcg2 n/a
10 TRCN0000325468 CCAAAGGGATTATCTGGAGAT pLKO_005 748 CDS 100% 4.050 2.835 N Abcg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011920.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.