Transcript: Mouse NM_011925.2

Mus musculus adhesion G protein-coupled receptor E5 (Adgre5), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Adgre5 (26364)
Length:
3253
CDS:
175..2631

Additional Resources:

NCBI RefSeq record:
NM_011925.2
NBCI Gene record:
Adgre5 (26364)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_011925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220767 GCGTCTGTAACCTGGGATATA pLKO.1 458 CDS 100% 13.200 18.480 N Adgre5 n/a
2 TRCN0000337671 GTCTGTAACCTGGGATATAAG pLKO_005 460 CDS 100% 13.200 18.480 N Adgre5 n/a
3 TRCN0000337673 GATTCCGAGTGTCTCACTTAA pLKO_005 1473 CDS 100% 13.200 9.240 N Adgre5 n/a
4 TRCN0000337674 TCACGTTCAAGTTCGACTTTA pLKO_005 1559 CDS 100% 13.200 9.240 N Adgre5 n/a
5 TRCN0000337594 ATGAAGGACAGCAGCACATAC pLKO_005 2643 3UTR 100% 10.800 7.560 N Adgre5 n/a
6 TRCN0000220765 GAGTGTTTACTACCTGGATTT pLKO.1 388 CDS 100% 10.800 7.560 N Adgre5 n/a
7 TRCN0000337595 GGCTATGGGCATGCAACATAC pLKO_005 2152 CDS 100% 10.800 7.560 N Adgre5 n/a
8 TRCN0000220766 GTCACGTTCAAGTTCGACTTT pLKO.1 1558 CDS 100% 4.950 3.465 N Adgre5 n/a
9 TRCN0000220764 CCATAGCACATGGCTATCCTA pLKO.1 2412 CDS 100% 0.300 0.210 N Adgre5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_011925.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.