Transcript: Human NM_012080.5

Homo sapiens pseudouridine 5'-phosphatase (PUDP), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
PUDP (8226)
Length:
2103
CDS:
41..727

Additional Resources:

NCBI RefSeq record:
NM_012080.5
NBCI Gene record:
PUDP (8226)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012080.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000370326 CCCAGTCTAACGTGTTGATAA pLKO_005 877 3UTR 100% 13.200 18.480 N PUDP n/a
2 TRCN0000365199 GTAATCGCTATGACAAGAAAT pLKO_005 141 CDS 100% 13.200 18.480 N PUDP n/a
3 TRCN0000365256 TGGATACTGAACGGCTGTATT pLKO_005 99 CDS 100% 13.200 18.480 N PUDP n/a
4 TRCN0000051203 CGTCGTTCGATATGAAGACAA pLKO.1 393 CDS 100% 4.950 6.930 N PUDP n/a
5 TRCN0000051207 GACGGAAACTTGAGCCGAGAT pLKO.1 626 CDS 100% 4.050 5.670 N PUDP n/a
6 TRCN0000370325 TTGCAGCTCCCGATGTCCAAA pLKO_005 233 CDS 100% 4.950 3.960 N PUDP n/a
7 TRCN0000051204 CAGTGGTGTTTCAAGAAATAT pLKO.1 120 CDS 100% 15.000 10.500 N PUDP n/a
8 TRCN0000370380 AGGCGGCACAGATTATAATAG pLKO_005 207 CDS 100% 13.200 9.240 N PUDP n/a
9 TRCN0000365198 GTGTATCAGTTTGGTAATATG pLKO_005 1056 3UTR 100% 13.200 9.240 N PUDP n/a
10 TRCN0000370324 TCATCATCCACCTGCGGAAAC pLKO_005 333 CDS 100% 6.000 4.200 N PUDP n/a
11 TRCN0000051206 GTTATGGGTAAGAAGGCATTA pLKO.1 185 CDS 100% 10.800 6.480 N PUDP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012080.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11262 pDONR223 100% 93.5% 93.4% None 1_42del;346G>A;456G>A n/a
2 ccsbBroad304_11262 pLX_304 0% 93.5% 93.4% V5 1_42del;346G>A;456G>A n/a
3 TRCN0000472581 CCAGACCTTACAAATCCACTCGAC pLX_317 59% 93.5% 93.4% V5 1_42del;346G>A;456G>A n/a
Download CSV