Transcript: Human NM_012140.5

Homo sapiens solute carrier family 25 member 10 (SLC25A10), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
SLC25A10 (1468)
Length:
1942
CDS:
144..1007

Additional Resources:

NCBI RefSeq record:
NM_012140.5
NBCI Gene record:
SLC25A10 (1468)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012140.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000038586 GCTGAAGACTCGCCTGATGAA pLKO.1 809 CDS 100% 4.950 6.930 N SLC25A10 n/a
2 TRCN0000038585 AGACTTGGTCAACGTCAGGAT pLKO.1 503 CDS 100% 2.640 3.696 N SLC25A10 n/a
3 TRCN0000038588 CCTGACTCGGTTCGCCATCTA pLKO.1 368 CDS 100% 1.650 2.310 N SLC25A10 n/a
4 TRCN0000422856 ACAACATCTTCACTCACTTTG pLKO_005 733 CDS 100% 10.800 7.560 N SLC25A10 n/a
5 TRCN0000374556 TGCTGAAGACTCGCCTGATGA pLKO_005 808 CDS 100% 4.950 3.465 N Slc25a10 n/a
6 TRCN0000038584 CCAGCTTTATTGCAGGTGGAT pLKO.1 757 CDS 100% 2.640 1.848 N SLC25A10 n/a
7 TRCN0000444984 TGCTAGCTCTGCACTTCGTGT pLKO_005 1442 3UTR 100% 2.640 1.848 N SLC25A10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012140.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00383 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00383 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476403 GGCCAAACATTTGCCCGCCGATTT pLX_317 37.6% 100% 100% V5 n/a
4 ccsbBroadEn_10756 pDONR223 100% 96.8% 96.9% None 264T>C;627_628ins27 n/a
5 ccsbBroad304_10756 pLX_304 0% 96.8% 96.9% V5 264T>C;627_628ins27 n/a
6 TRCN0000469907 TCGATGTTAACGCCTCGAGCACTT pLX_317 39.5% 96.8% 96.9% V5 264T>C;627_628ins27 n/a
Download CSV