Transcript: Human NM_012170.3

Homo sapiens F-box protein 22 (FBXO22), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
FBXO22 (26263)
Length:
1717
CDS:
106..936

Additional Resources:

NCBI RefSeq record:
NM_012170.3
NBCI Gene record:
FBXO22 (26263)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012170.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000425126 AGCACCTTCGTGTTGAGTAAC pLKO_005 160 CDS 100% 10.800 15.120 N FBXO22 n/a
2 TRCN0000004311 CGCATCTTACCACATACAGTT pLKO.1 391 CDS 100% 4.950 6.930 N FBXO22 n/a
3 TRCN0000216970 CGACCTCAGGAAATAGAAATT pLKO.1 595 CDS 100% 13.200 10.560 N Fbxo22 n/a
4 TRCN0000004309 GTAGCAATCGACCTCAGGAAA pLKO.1 587 CDS 100% 4.950 3.960 N FBXO22 n/a
5 TRCN0000419566 AGTCAGCACTTTCAGTGATAT pLKO_005 822 CDS 100% 13.200 9.240 N FBXO22 n/a
6 TRCN0000215784 CTTTATTATTCCCTCAAATTG pLKO.1 632 CDS 100% 13.200 9.240 N Fbxo22 n/a
7 TRCN0000004308 CTTCGTGTGGTCCTTGTCTTT pLKO.1 754 CDS 100% 4.950 3.465 N FBXO22 n/a
8 TRCN0000010869 GTGTGGTCCTTGTCTTTGGTT pLKO.1 758 CDS 100% 3.000 2.100 N FBXO22 n/a
9 TRCN0000004310 CCCAAACAATGCCAAGTCCTT pLKO.1 523 CDS 100% 2.640 1.848 N FBXO22 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012170.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08009 pDONR223 100% 68% 65.7% None (many diffs) n/a
2 ccsbBroad304_08009 pLX_304 0% 68% 65.7% V5 (many diffs) n/a
3 TRCN0000468178 GGCGTTCTCATGGAACCTGAAACC pLX_317 32.8% 68% 65.7% V5 (many diffs) n/a
Download CSV