Transcript: Human NM_012256.4

Homo sapiens zinc finger protein 212 (ZNF212), mRNA.

Source:
NCBI, updated 2019-08-15
Taxon:
Homo sapiens (human)
Gene:
ZNF212 (7988)
Length:
2807
CDS:
129..1616

Additional Resources:

NCBI RefSeq record:
NM_012256.4
NBCI Gene record:
ZNF212 (7988)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012256.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415490 ACGTGATGGAGAGTAACTATG pLKO_005 631 CDS 100% 10.800 15.120 N ZNF212 n/a
2 TRCN0000415183 AGCGGAGTTGGGTACAGAGAT pLKO_005 695 CDS 100% 4.950 6.930 N ZNF212 n/a
3 TRCN0000422632 GAAGAGTTCTGGGAAGTATAA pLKO_005 1994 3UTR 100% 13.200 9.240 N ZNF212 n/a
4 TRCN0000415004 GAGAATGATGGCGTCTGTTTC pLKO_005 558 CDS 100% 10.800 7.560 N ZNF212 n/a
5 TRCN0000423954 AGTACCAAGCCAAGCCCAAAG pLKO_005 1741 3UTR 100% 6.000 4.200 N ZNF212 n/a
6 TRCN0000013119 CCTGGAGAGTTCTCATGCATT pLKO.1 819 CDS 100% 4.950 3.465 N ZNF212 n/a
7 TRCN0000013120 CGAATGTTCTGAGTGTGAGAT pLKO.1 1076 CDS 100% 4.950 3.465 N ZNF212 n/a
8 TRCN0000429783 GAGGAGCCTGTTGGTAGTAGA pLKO_005 939 CDS 100% 4.950 3.465 N ZNF212 n/a
9 TRCN0000013122 GAGTTCCCTCATCTGTGGTTA pLKO.1 1400 CDS 100% 4.950 3.465 N ZNF212 n/a
10 TRCN0000431729 GATCAAACAGGAGCTACAGTA pLKO_005 773 CDS 100% 4.950 3.465 N ZNF212 n/a
11 TRCN0000013121 GCTCCACACCTTTAACTTCTT pLKO.1 169 CDS 100% 4.950 3.465 N ZNF212 n/a
12 TRCN0000416471 GCATGTCCAAGAGAGGTTCTC pLKO_005 1328 CDS 100% 4.050 2.835 N ZNF212 n/a
13 TRCN0000013118 CCAGTGAAGTTGCTGATGGTA pLKO.1 2397 3UTR 100% 3.000 1.800 N ZNF212 n/a
14 TRCN0000179737 CAACAGGAACTTCTGGATCTT pLKO.1 485 CDS 100% 4.950 2.475 Y LOC155060 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012256.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01852 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01852 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000470556 TTCTATCAGTACCGACTGTTTGTC pLX_317 24.7% 100% 100% V5 n/a
4 ccsbBroadEn_10522 pDONR223 100% 20.5% 17.9% None (many diffs) n/a
5 ccsbBroad304_10522 pLX_304 0% 20.5% 17.9% V5 (many diffs) n/a
6 TRCN0000466099 CTGACAACCTTTTAGAATTATCCT pLX_317 100% 20.5% 17.9% V5 (many diffs) n/a
Download CSV