Transcript: Human NM_012281.3

Homo sapiens potassium voltage-gated channel subfamily D member 2 (KCND2), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
KCND2 (3751)
Length:
5830
CDS:
1459..3351

Additional Resources:

NCBI RefSeq record:
NM_012281.3
NBCI Gene record:
KCND2 (3751)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012281.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430481 ACAATTGGAATAAGGTCTAAG pLKO_005 3353 3UTR 100% 10.800 15.120 N KCND2 n/a
2 TRCN0000044996 GCATCCCAAATGCCAATGTAT pLKO.1 3074 CDS 100% 5.625 7.875 N KCND2 n/a
3 TRCN0000044993 GCAGAGCAAACGGAATGGTTT pLKO.1 2793 CDS 100% 4.950 3.960 N KCND2 n/a
4 TRCN0000412493 ACCTGTTATACAGAGTAATAT pLKO_005 3540 3UTR 100% 15.000 10.500 N KCND2 n/a
5 TRCN0000427847 TTGGCTATGATGAAGATTATT pLKO_005 3748 3UTR 100% 15.000 10.500 N KCND2 n/a
6 TRCN0000044997 ACCCAGAAACTCAGCAGTATT pLKO.1 1688 CDS 100% 13.200 9.240 N KCND2 n/a
7 TRCN0000044994 GCATGGAAGTTGCAACTGTTA pLKO.1 2966 CDS 100% 4.950 3.465 N KCND2 n/a
8 TRCN0000069520 CGACTGCTGTTATGAGGAGTA pLKO.1 1848 CDS 100% 4.050 2.835 N Kcnd2 n/a
9 TRCN0000044995 CGATGAAGAACTGGCCTTCTT pLKO.1 1803 CDS 100% 0.495 0.347 N KCND2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012281.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00893 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00893 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000466575 AAACTAGCCTCATCAAAATCACTA pLX_317 16.5% 100% 100% V5 n/a
Download CSV