Transcript: Human NM_012296.3

Homo sapiens GRB2 associated binding protein 2 (GAB2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-24
Taxon:
Homo sapiens (human)
Gene:
GAB2 (9846)
Length:
6062
CDS:
161..2077

Additional Resources:

NCBI RefSeq record:
NM_012296.3
NBCI Gene record:
GAB2 (9846)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012296.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421495 CTGATCGGAAAGCAAAGCCAA pLKO_005 1602 CDS 100% 2.640 2.112 N GAB2 n/a
2 TRCN0000154991 GCCCTGAATGTGTGCCTTAAA pLKO.1 4494 3UTR 100% 13.200 9.240 N GAB2 n/a
3 TRCN0000155271 GCTCCACTTCTGCAAGGTTAA pLKO.1 5107 3UTR 100% 10.800 7.560 N GAB2 n/a
4 TRCN0000155921 CAGCCAACTCTGTTCACGTTT pLKO.1 542 CDS 100% 4.950 3.465 N GAB2 n/a
5 TRCN0000415678 CTCTACTTGCACCAGTGCATA pLKO_005 623 CDS 100% 4.950 3.465 N GAB2 n/a
6 TRCN0000413156 GCCCATCACTTTGACTCACTT pLKO_005 1493 CDS 100% 4.950 3.465 N GAB2 n/a
7 TRCN0000154706 GCGAAGAGAACTATGTCCCTA pLKO.1 1785 CDS 100% 2.640 1.848 N GAB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012296.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02260 pDONR223 100% 94.3% 94.3% None 0_1ins114 n/a
2 ccsbBroad304_02260 pLX_304 0% 94.3% 94.3% V5 0_1ins114 n/a
3 TRCN0000491402 AAACCAATAGCTCTAAGTCGGAGC pLX_317 15.1% 94.3% 94.3% V5 0_1ins114 n/a
4 TRCN0000488960 CCGCACTGGTTTAATACCTCTCGT pLX_317 18.3% 94.3% 94.3% V5 (not translated due to prior stop codon) 0_1ins114 n/a
Download CSV