Transcript: Human NM_012347.4

Homo sapiens F-box protein 9 (FBXO9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
FBXO9 (26268)
Length:
4438
CDS:
52..1395

Additional Resources:

NCBI RefSeq record:
NM_012347.4
NBCI Gene record:
FBXO9 (26268)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012347.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000307329 TATTTCCCGCATGGCATAATG pLKO_005 1820 3UTR 100% 13.200 18.480 N FBXO9 n/a
2 TRCN0000294443 TGGAATATTACAGGTACATAA pLKO_005 932 CDS 100% 13.200 18.480 N FBXO9 n/a
3 TRCN0000294444 TTCGGTTTGATGGCGTGTATA pLKO_005 842 CDS 100% 13.200 18.480 N FBXO9 n/a
4 TRCN0000034309 CCTGATATAGAGTTCAAGATT pLKO.1 424 CDS 100% 5.625 7.875 N FBXO9 n/a
5 TRCN0000034311 CCACGTTTAAGAACTAGGAAT pLKO.1 1015 CDS 100% 4.950 6.930 N FBXO9 n/a
6 TRCN0000034313 CCAGGTGTAAGCTCTAGCAAT pLKO.1 217 CDS 100% 4.950 6.930 N FBXO9 n/a
7 TRCN0000034312 CCAGAGGTTCAACAAACTCAT pLKO.1 1233 CDS 100% 4.950 3.465 N FBXO9 n/a
8 TRCN0000286987 CCAGAGGTTCAACAAACTCAT pLKO_005 1233 CDS 100% 4.950 3.465 N FBXO9 n/a
9 TRCN0000034310 CCTCAGATCATTGGAGCAGTT pLKO.1 678 CDS 100% 4.050 2.835 N FBXO9 n/a
10 TRCN0000286988 CCTCAGATCATTGGAGCAGTT pLKO_005 678 CDS 100% 4.050 2.835 N FBXO9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012347.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02945 pDONR223 100% 90.1% 90.1% None 1_132del n/a
2 ccsbBroad304_02945 pLX_304 0% 90.1% 90.1% V5 1_132del n/a
3 TRCN0000469604 AAAATAGTTGCTAGAACCGGCGCT pLX_317 28.3% 90.1% 90.1% V5 1_132del n/a
Download CSV