Transcript: Human NM_012396.5

Homo sapiens pleckstrin homology like domain family A member 3 (PHLDA3), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PHLDA3 (23612)
Length:
2749
CDS:
403..786

Additional Resources:

NCBI RefSeq record:
NM_012396.5
NBCI Gene record:
PHLDA3 (23612)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012396.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183331 GCCATTAGCATTTCATGTCTT pLKO.1 1474 3UTR 100% 4.950 3.960 N PHLDA3 n/a
2 TRCN0000183624 GTTTGGCCATTAGCATTTCAT pLKO.1 1469 3UTR 100% 5.625 3.938 N PHLDA3 n/a
3 TRCN0000179973 CACCATCTTTCCTTCATGCTA pLKO.1 798 3UTR 100% 3.000 2.100 N PHLDA3 n/a
4 TRCN0000180589 GCACCATCTTTCCTTCATGCT pLKO.1 797 3UTR 100% 2.640 1.848 N PHLDA3 n/a
5 TRCN0000198701 CCCTTTCTTTGCACACTTCTT pLKO.1 1382 3UTR 100% 4.950 2.970 N Phlda3 n/a
6 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2100 3UTR 100% 10.800 5.400 Y SMIM11A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012396.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02810 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02810 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473351 TCCTCCGCCATTATTTTCTCTTTA pLX_317 97.2% 100% 100% V5 n/a
Download CSV