Transcript: Human NM_012431.3

Homo sapiens semaphorin 3E (SEMA3E), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-07-23
Taxon:
Homo sapiens (human)
Gene:
SEMA3E (9723)
Length:
7273
CDS:
598..2925

Additional Resources:

NCBI RefSeq record:
NM_012431.3
NBCI Gene record:
SEMA3E (9723)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012431.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060334 CCACGATCTTTACAAGCGAAA pLKO.1 2407 CDS 100% 4.050 5.670 N SEMA3E n/a
2 TRCN0000060335 CGGAGACAAGATGTTCGACAT pLKO.1 2272 CDS 100% 4.050 5.670 N SEMA3E n/a
3 TRCN0000060336 GCGGGTGAATGTGCAAATTAT pLKO.1 931 CDS 100% 15.000 10.500 N SEMA3E n/a
4 TRCN0000060333 CCACTTTAATTGGTAGTGAAT pLKO.1 1136 CDS 100% 4.950 3.465 N SEMA3E n/a
5 TRCN0000060337 GCAGAGAATACTGGTGAATAA pLKO.1 1425 CDS 100% 13.200 7.920 N SEMA3E n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 6337 3UTR 100% 4.950 2.475 Y ERAP2 n/a
7 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 6338 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012431.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07475 pDONR223 100% 99.9% 100% None 1497G>A n/a
2 ccsbBroad304_07475 pLX_304 0% 99.9% 100% V5 1497G>A n/a
3 TRCN0000477055 CGTTTGGGGATGGAGCACACGGTC pLX_317 13.9% 99.9% 100% V5 1497G>A n/a
Download CSV