Transcript: Human NM_012432.4

Homo sapiens SET domain bifurcated histone lysine methyltransferase 1 (SETDB1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
SETDB1 (9869)
Length:
4412
CDS:
167..4039

Additional Resources:

NCBI RefSeq record:
NM_012432.4
NBCI Gene record:
SETDB1 (9869)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_012432.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276105 AGTTAGAGACATGGGTAATAC pLKO_005 354 CDS 100% 13.200 18.480 N SETDB1 n/a
2 TRCN0000147130 CAGTGACTAATTGTGAGTCTT pLKO.1 429 CDS 100% 4.950 3.960 N SETDB1 n/a
3 TRCN0000285490 CAGTGACTAATTGTGAGTCTT pLKO_005 429 CDS 100% 4.950 3.960 N SETDB1 n/a
4 TRCN0000092975 CCCGAGGCTTTGCTCTTAAAT pLKO.1 3657 CDS 100% 15.000 10.500 N Setdb1 n/a
5 TRCN0000276103 ATCCCTCCCATCCCATATTTG pLKO_005 4281 3UTR 100% 13.200 9.240 N SETDB1 n/a
6 TRCN0000305552 TGGCACAAAGGCACCCTTATT pLKO_005 803 CDS 100% 13.200 9.240 N Setdb1 n/a
7 TRCN0000146969 CCAGACATATAGATCACCTTT pLKO.1 1735 CDS 100% 4.950 3.465 N SETDB1 n/a
8 TRCN0000179094 CGTGACTTCATAGAGGAGTAT pLKO.1 1154 CDS 100% 4.950 3.465 N SETDB1 n/a
9 TRCN0000276106 CGTGACTTCATAGAGGAGTAT pLKO_005 1154 CDS 100% 4.950 3.465 N SETDB1 n/a
10 TRCN0000148112 GCTCAGATGATAACTTCTGTA pLKO.1 2880 CDS 100% 4.950 3.465 N SETDB1 n/a
11 TRCN0000276169 GCTCAGATGATAACTTCTGTA pLKO_005 2880 CDS 100% 4.950 3.465 N SETDB1 n/a
12 TRCN0000339743 CTAACTCTGGCTACCAGTATA pLKO_005 2448 CDS 100% 13.200 9.240 N Setdb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_012432.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10231 pDONR223 100% 30.5% 29.7% None (many diffs) n/a
2 ccsbBroad304_10231 pLX_304 11.1% 30.5% 29.7% V5 (many diffs) n/a
Download CSV