Transcript: Human NM_013318.3

Homo sapiens proline rich coiled-coil 2B (PRRC2B), mRNA.

Source:
NCBI, updated 2019-05-04
Taxon:
Homo sapiens (human)
Gene:
PRRC2B (84726)
Length:
11062
CDS:
56..6745

Additional Resources:

NCBI RefSeq record:
NM_013318.3
NBCI Gene record:
PRRC2B (84726)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013318.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000254300 GTAGGACGTAGGGTCTTATTT pLKO_005 9449 3UTR 100% 15.000 21.000 N PRRC2B n/a
2 TRCN0000254301 GTATACCACCCACCTACATAC pLKO_005 869 CDS 100% 10.800 8.640 N PRRC2B n/a
3 TRCN0000254299 TTCCACTTTGCCGACAGTAAA pLKO_005 6461 CDS 100% 13.200 9.240 N PRRC2B n/a
4 TRCN0000265532 CCCGTATTCCTCCTCGATTTG pLKO_005 4842 CDS 100% 10.800 7.560 N PRRC2B n/a
5 TRCN0000098965 GCCAGGAAATTGCATGTGAAA pLKO.1 9214 3UTR 100% 4.950 3.465 N Prrc2b n/a
6 TRCN0000098966 GCCGACAGTAAACAGAATGTT pLKO.1 6470 CDS 100% 5.625 3.375 N Prrc2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013318.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12846 pDONR223 100% 14.6% 14.6% None 1_5709del n/a
2 ccsbBroad304_12846 pLX_304 0% 14.6% 14.6% V5 1_5709del n/a
3 TRCN0000465640 AGGGGGGCCACCAGTTGCCTGAGG pLX_317 36% 14.6% 14.6% V5 1_5709del n/a
Download CSV