Transcript: Human NM_013321.4

Homo sapiens sorting nexin 8 (SNX8), mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
SNX8 (29886)
Length:
4704
CDS:
21..1418

Additional Resources:

NCBI RefSeq record:
NM_013321.4
NBCI Gene record:
SNX8 (29886)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_013321.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153978 CTGATCCGGAACATCTACAAT pLKO.1 690 CDS 100% 5.625 7.875 N SNX8 n/a
2 TRCN0000343026 CTGATCCGGAACATCTACAAT pLKO_005 690 CDS 100% 5.625 7.875 N SNX8 n/a
3 TRCN0000157291 CTCATATTCGGGAAGGAGCTA pLKO.1 780 CDS 100% 2.640 3.696 N SNX8 n/a
4 TRCN0000158119 CTTCGTCAACTCTCAGATCCA pLKO.1 1271 CDS 100% 2.640 3.696 N SNX8 n/a
5 TRCN0000343028 CTTCGTCAACTCTCAGATCCA pLKO_005 1271 CDS 100% 2.640 3.696 N SNX8 n/a
6 TRCN0000157548 GCTAAGTGCAATAGGGTCTGA pLKO.1 797 CDS 100% 2.640 3.696 N SNX8 n/a
7 TRCN0000343027 GCTAAGTGCAATAGGGTCTGA pLKO_005 797 CDS 100% 2.640 3.696 N SNX8 n/a
8 TRCN0000153495 CGGATGTGCAGAACAAGTTAA pLKO.1 559 CDS 100% 13.200 9.240 N SNX8 n/a
9 TRCN0000342961 CGGATGTGCAGAACAAGTTAA pLKO_005 559 CDS 100% 13.200 9.240 N SNX8 n/a
10 TRCN0000156955 GCACAAGTACAGCCTGATGAA pLKO.1 1058 CDS 100% 4.950 3.465 N SNX8 n/a
11 TRCN0000151477 CAGAACAAGTTAAAGGAGTCA pLKO.1 567 CDS 100% 2.640 1.848 N SNX8 n/a
12 TRCN0000157696 CAGACGGTACAATGACTTCGT pLKO.1 341 CDS 100% 2.640 1.848 N SNX8 n/a
13 TRCN0000157806 CTTCCTGAAGCATGTGGAGTA pLKO.1 284 CDS 100% 4.050 2.430 N SNX8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_013321.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08130 pDONR223 100% 99.8% 100% None 729A>G;1128T>C n/a
2 ccsbBroad304_08130 pLX_304 0% 99.8% 100% V5 729A>G;1128T>C n/a
3 TRCN0000475084 TGCTTGTGAGTACACCCCTGTATA pLX_317 20.5% 99.8% 100% V5 729A>G;1128T>C n/a
Download CSV